NOTA PRELIMINAR Este trabajo de investigación ha sido financiado con cargo a los proyectos subvencionados por el Ministerio de Ciencia y Tecnología (BFU2006- 103627BMC), el Instituto de Salud Carlos III (FIS-FEDER, PS09/01075) y la Junta de Castilla y León (SA033A05, SA126A07, Biomedicina SAN673/SA10/08). El autor de la Memoria ha disfrutado de una beca de colaboración USAL- Banco Santander para estudiantes Iberoamericanos (octubre 2008-octubre 2011). Los resultados recogidos en esta Memoria han sido en parte publicados en tres artículos y presentados en cuatro congresos: Artículos: Nancy Sarmiento, Carmen Sánchez-Bernal, Manuel Ayra, Nieves Pérez, Angel Hernández-Hernández, José J. Calvo, Jesús Sánchez-Yagüe. Changes in the expression and dynamics of SHP-1 and SHP-2 during cerulein-induced acute pancreatitis in rats. Biochim. Biophys. Acta. (Mol. Bas. Dis.) (2008) 1782, 271- 279. Nancy Sarmiento, Carmen Sánchez-Bernal, Nieves Pérez, Arturo Mangas, José L. Sardina, José J. Calvo, Jesús Sánchez-Yagüe. Rolipram and SP600125 suppress the early increase in PTP1B expression during cerulein- induced pancreatitis in rats. Pancreas (2010) 39, 639-645. Nancy Sarmiento, Jesús Sánchez-Yagüe, Pedro P.Juanes, Nieves Pérez, Laura Ferreira, Violeta García-Hernández, Arturo Mangas, José J. Calvo, Carmen Sánchez-Bernal. Changes in the morphology and lability of lysosomal subpopulations in cerulein-induced acute pancreatitis. Digest. Liver Dis. (2011) 43, 132-138. Congresos: N Sarmiento, MC Sánchez Rodríguez, N Pérez-González, JJ Calvo, A Hernández-Hernández, J Sánchez-Yagüe. Dynamics of the protein tyrosine phosphatases PTP 1B, PTP 1C and PTP 1D in experimental acute pancreatitis. Effect of Nitric Oxide. 9th Meeting of the Spanish Bilio-Pancreatic Club. Valencia, 25-26 de noviembre de 2005. Pancreatology, vol 6, pág 47, 2006. N. Sarmiento Sandoval, M.C. Sánchez Bernal, M. Ayra Rivas, N. Pérez González, J.J. Calvo Andrés, A. Hernández Hernández y J. Sánchez Yagüe. Expresión de SH-PTP1 en la Pancreatitis Aguda Experimental. Efecto de la Inhibición de JNK y ERK1/2, o de la Fosfodiesterasa Tipo IV. X Reunión del Club Español Biliopancreático. Santander, 28-29 de septiembre de 2007. Gastroenterología y Hepatología, Vol 30, pág 437, 2007. N. Sarmiento Sandoval, M.C. Sánchez Bernal, V. García Hernández, N. Pérez González , A. Mangas, J.J. Calvo Andrés, J. Sánchez Yagüe. Rolipram y SP600125 suprimen el aumento de la expresión de PTP1B durante la pancretitis aguda experimental. XI Reunión del Club Español Biliopancreático. Vitoria-Gasteiz, 22-24 de octubre de 2009. Gastroenterología y Hepatología, Vol 33(1) e8, 2010. Nancy Sarmiento, Carmen Sánchez Bernal, Nieves Pérez González, Violeta García Hernández, Angel Hernández Hernández, José J calvo Andrés, Jesús Sánchez Yagüe. Dinámica de la expresión de LAMP-2 durante el desarrollo de la pancreatitis aguda experimental. XXXIII Congreso de la Sociedad Española de Bioquímica y Biología Molecular. Córdoba, 14-17 de septiembre de 2010. Libro de resúmenes, Grupo Bases Moleculares de la Patología, Abstract PO22. Sobre la base bibliográfica relativa a nuestro tema de estudio, nos planteamos como objetivo general, estudiar en pancreatitis aguda experimental edematosa, la dinámica de algunas proteínas pancreáticas implicadas en rutas de señalización alteradas en esta patología, así como los posibles cambios en la estabilidad lisosómica. Dicho objetivo general se concretó en los siguientes objetivos específicos: 1. Estudiar los cambios de expresión y dinámica de las PTPs con dominios SH2: SHP-1 y SHP-2, en la PA inducida por ceruleína. • Estudiar la especificidad de dichos cambios respecto a otros modelos de PA. • Estudiar la influencia de la infiltración por neutrófilos en dichos cambios. • Estudiar la influencia de la inhibición de las MAPKs: JNK y ERK 1/2, así como de la fosfodiesterasa tipo IV, sobre los mismos. • Analizar la distribución subcelular de las dos PTPs durante el desarrollo de la PA inducida por ceruleína. 2. Investigar los cambios de expresión de la PTP PTP1B durante el desarrollo de la PA inducida por ceruleína. • Valorar la especificidad de dichos cambios respecto a otros modelos de PA. • Estudiar la influencia de la infiltración por neutrófilos en dichos cambios. • Estudiar la influencia de la inhibición de las MAPKs: JNK y ERK 1/2, así como de la fosfodiesterasa tipo IV, sobre los mismos. 3. Desarrollar un método para el aislamiento de subpoblaciones de lisosomas de páncreas de rata que nos permita el estudio futuro de las proteínas lisosómicas • Analizar la estabilidad de la membrana lisosómica en la subpoblación de lisosomas primarios, determinando la dinámica de dos formas de la N-acetil-¿-D-glucosaminidasa en la PA. 4. Investigar los cambios de expresión y dinámica de la proteína lisosómica LAMP-2 durante el desarrollo de la PA inducida por ceruleína. Preámbulo: A continuación presentamos los resultados en relación a los objetivos planteados, en la forma de artículos publicados y manuscrito. Changes in the expression and dynamics of SHP-1 and SHP-2 during cerulein-induced acute pancreatitis in rats Nancy Sarmientoª, Carmen Sánchez-Bernalª, Manuel Ayraª, Nieves Pérezª, Angel Hernández-Hernándezª, José J. Calvo, Jesús Sánchez-Yagüeª* Biochimica et Biophysica Acta 1782 (2008) 271 – 279 Abstract Protein tyrosine phosphatases (PTPs) are important regulators of cell functions but data on different PTP expression and dynamics in acute pancreatitis (AP) are very scarce. Additionally, both c-Jun N-terminal kinases (JNK) and extracellular signal-regulated kinases (ERK1/2), together with intracellular cAMP levels in inflammatory cells, play an essential role in AP. In this study we have detected an increase in PTP SHP-1 and SHP-2 in the pancreas at the level of both protein and mRNA as an early event during the development of Cerulein (Cer)-induced AP in rats. Nevertheless, while SHP-2 protein returned to baseline levels in the intermediate or later phases of AP, SHP-1 protein expression remained increased throughout the development of the disease. The increase in SHP-2 protein expression was associated with changes in its subcellular distribution, with higher percentages located in the fractions enriched in lysosomes+mitochondria or microsomes. Furthermore, while the increase in SHP-2 protein was also observed in sodium-taurocholate duct infusion or bile-pancreatic duct obstruction AP, that of SHP-1 was specific to the Cer-induced model. Neutrophil infiltration did not affect the increase in SHP-1 protein, but favoured the return of SHP-2 protein to control levels, as indicated when rats were rendered neutropenic by the administration of vinblastine sulfate. Inhibition of JNK and ERK1/2 with SP600125 pre-treatment further increased the expression of both SHP-1 and SHP-2 proteins in the early phase of Cer-induced AP, while the inhibition of type IV phosphodiesterase with rolipram only suppressed the increase in SHP-2 protein expression during the same phase. Our results show that AP is associated with increases in the expression of SHP-1 and SHP-2 and changes in the dynamics of SHP-2 subcellular distribution in the early phase of Cer-induced AP. Finally, both JNK and ERK1/2 and intracellular cAMP levels are able to modulate the expression of these PTPs. © 2008 Elsevier B.V. All rights reserved. Keywords: SHP-1; SHP-2; Acute pancreatitis; Cerulein; SP600125; Rolipram 1. Introduction In the pathogenesis of acute pancreatitis (AP) many factors, including activated pancreatic enzymes, cytokines, chemokines, free radicals, blood flow, and neurogenic factors, have been reported. Nevertheless, the pathophysiology of the disease remains incompletely understood, especially the early acinar events. It has been suggested that it would be important to detect rapid early events and signalling mechanisms in AP because these events would probably be translated into long-term res- ponses that would determine the development of pancreatitis [1]. One of the animal models of AP is that induced by supramaximal secretagogue stimulation. Usually, the trophic agent cerulein [Cer, an analogue of cholecystokinin (CCK)] is used in this model. Different doses of Cer (ranging from 5 to even 100 µg/Kg) have been used to induce AP in rats. Under the conditions used here [20 µg/Kg subcutaneous (s.c.) injection] the manifestations of pancreatitis include hyperamylasemia, interstitial edema, increase pancreatic cell size, increased pancreatic weight, histological damages, including increased vacuolization and other morphological derangements, and neutrophil infiltration [2–5]. With current ongoing research, the intracellular mechanisms by which CCK or Cer regulate pancreatic acinar function appear to be increasingly complex. Through Gq proteins, CCK and Cer lead to an increase in cytosolic free Ca2+. Ca2+, diacylglycerol and cAMP activate exocytosis processes. Moreover, it is known that both CCK and Cer activate pancreatic protein tyrosine kinases (PTK) [6,7] and that tyrosine phosphorylation plays important roles in the regulation of many cell functions. Cer-induced AP also activates the mitogen-activated protein kinase (MAPKs) cascade, especially extracellular signal- regulated kinase (ERK1/2) and c-Jun N-terminal kinase (JNK), whose activation requires the phosphorylation of both tyrosine and threonine residues [8,9]. p38MAPK is also activated by CCK and Cer. Other signalling pathways are also activated in AP, e.g. the adenosine A1-receptor pathway [10], which decreases intracellular cAMP levels. In this regard, it is known that type IV phosphodiesterase inhibitors ameliorate Cer-induced AP [11]. It is also clear that pancreatitis requires the dissociation of cell–cell contacts [12] and adherens junctions [13], and that tyrosine phosphorylation is important for the maintenance of an intact cell adhesion complex [14]. The discovery of the role of PTK in the regulation of the levels of tyrosine phosphorylation has led phosphotyrosine phosphatases (PTP) to become better appreciated as important regulators of cell functions. The structurally very similar SH2-domain containing PTPs SHP-1 and SHP-2 have been proposed to have different roles in signal transduction: SHP-1 is expressed highly in hematopoietic cells and at a moderate level in many other types of cells and plays a largely negative signalling role in hematopoietic cells. SHP-2 is more widely expressed and plays a largely positive role in the cell signalling leading to cell activation. Nevertheless, it seems that the functional nature of SHP-1 and SHP-2 depends on the systems involved. SHP-1 has been implicated in the Jak-Stat and MAPK pathways [15]. SHP-2 has compound signalling functions and it appears to be involved in a variety of signal transduction processes, such as the Ras-Raf-MAPK, Jak-Stat, PI3 kinase and NF-¿B pathways [16]. Even within a single signalling pathway, SHP-2 may act at multiple sites to participate in signal transduction. All the above SHP-1 and SHP-2 signalling pathways have been implicated in the development of AP. Data on PTP in AP are very scarce although it is well documented that these signalling enzymes are inactivated by reactive oxygen species (ROS) [17] or secondary products of oxidation [18,19] that may form during AP development [20,21]. Essentially, only one function of SHP-1 and PTP¿ in the regulation of cell adhesion in the pancreas after mild experimental Cer-induced pancreatitis in rats has been described [12]. No data are available about changes in the expression of SH2-domain PTPs either at the level of RNA or protein, and neither is the dynamics of their subcellular location along the development of pancreatitis known. Considering the importance of determining molecules or genes whose expression changes in the early phase of AP development, together with the signalling mechanisms that may modulate such expression, here we studied the expression and dynamics of the subcellular location of SHP-1 and SHP-2 in the development of Cer-induced AP, as well as the effect of SP600125, a new JNK and ERK 1/2 inhibitor, and rolipram, a type IV phosphodiesterase inhibitor, on SHP-1 and SHP-2 expression levels in the early phase of AP development. 2. Materials and methods 2.1. Reagents Bovine serum albumin (BSA), Cer, dithiothreitol (DTT), Percoll, phenyl-methylsulfonyl fluoride (PMSF), Protein Inhibitor Cocktail, rolipram, sodium-taurocholate, soybean trypsin inhibitor, SP600125, Trizol Reagent, vinblastine sulfate were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Polyvinylidene difluoride (PVDF) membranes were obtained from Amersham Biosciences, Spain. Monoclonal antibody anti-PTP-1 (D-11) was obtained from Santa Cruz Biotechnology, Inc, CA, USA. Monoclonal antibody anti-PTP-2 was obtained from BD Biosciences Pharmingen, San Diego, CA, USA. Reverse Transcriptase (RevertAid M-MULV), Taq polymerase, dNTP's and the Ribolock Ribonuclease inhibitor used in the reverse transcriptase-polymerase chain reaction (RT-PCR) were purchased from Fermentas Life Sciences, Germany. Oligonucleotides were obtained from Isogen life Sciences, The Netherlands. Isopropanol was purchased from Panreac, Spain. The Myeloperoxidase (MPO) Fluorimetric Detection Kit was purchased from Assay Desigs, Inc, USA. 2.2. Animals Male Wistar rats weighing 250–280 g were used. The animals were given a standard rat chow diet and were fasted overnight before experiments with free access to water. Care was provided in accordance with the procedures outlined in European Community guidelines on ethical animal research (86/609/EEC), and protocols were approved by the Animal Care Committee of the University of Salamanca. 2.3. Induction of AP and preparation of samples Rats received 4 s.c. injections of 20 µg Cer/kg body weight or its vehicle (0.9% NaCl) at hourly intervals. At 2, 4 or 9 h after the first injection, the animals were killed by cervical dislocation. The pancreases were rapidly harvested and immediately used for experiments. Serum samples were stored at -80°C until amylase determination. In some cases, AP was also induced by sodium-taurocholate duct infusion or bile-pancreatic duct obstruction (BPDO) [22, 23, res- pectively]. Pancreases were dissected out from the surrounding fat tissue and then homogeneized with a Potter Elvehjem device in 10 volumes (v/w) of homogenization buffer (3 mM imidazole buffer, pH 7.4 containing 0.25 M sucrose, 1 mM EDTA, 1 mM PMSF, 100 µg/ml trypsin inhibitor and 2 µl/ml Protease Inhibitor Cocktail). The subcellular fractionation was done in a postnuclear homogenate from 4 pancreases as described before [21]. Four subcellular fractions were obtained: the zymogen (Z), lysosomes plus mitochondria (L+M), microsomes (Mic) and soluble (S) fractions. Serum amylase was measured in the Roche Modular Analyzer by the method of Lorentz [24]. 2.4. Induction of neutropenia Vinblastine sulfate was dissolved in 10 mM sodium phosphate buffer, 147 mM NaCl, 2.7 mM KCl (pH 7.4) and administered to rats intravenously (i.v.) at a dose of 0.75 mg/kg on day 1, as previously described [26]. At this dose, animals become neutropenic between days 4 and 6 [26]. On day 5 following vinblastine sulfate or saline administration, the animals were treated with 2 doses of Cer (20 µg Cer/kg, administered at hourly intervals) to induce AP. 2.5. Inhibition of JNK- and ERK1/2 by SP600125 in Cer-induced AP Rats received intraperitoneal (i.p.) injections of SP600125 (15 mg/kg) or its vehicle (1 ml/kg of a 10% DMSO/NaCl solution) both 2 h before and 30 min after the first Cer injection [9]. Two hours after the first injection of SP600125, the rats were injected subcutaneously with Cer (20 µg Cer/kg) or its vehicle (0.9% NaCl) at hourly intervals. The animals were sacrificed 2 h after the first Cer injection (early phase of Cer-induced AP). 2.1. Inhibition of type IV phosphodiesterase by rolipram in Cer-induced AP Rats received i.p. injections of rolipram (5 mg/kg) or its vehicle (1 ml/kg of a 10% DMSO/NaCl solution) both 30 min before and 30 min after the first Cer injection [27]. Thirty minutes after the first injection of rolipram, the rats were injected subcutaneously with Cer (20 µg Cer/kg) or its vehicle (0.9% NaCl) at hourly intervals. The animals were sacrificed 2 h after the first Cer injection (early phase of Cer-induced AP). 2.7. RNA preparation and RT-PCR Total RNA was isolated from the pancreas and brain of the same rat by immediate solubilization in Trizol Reagent and isopropanol purification. RNA concentrations were determined by absorbance, and RNA integrity was checked by agarose electrophoresis. Reverse transcription was completed by incubating 2 µg of total RNA with 0.5 µg of a 18-mer oligo(dT) primer at 42 °C for 1 h, using 200 U of RevertAid M-MuLV Reverse Transcriptase in a solution containing 50 mM Tris–HCl, pH 8.3, 50 mM KCl, 4 mM MgCl2, 10 mM DTT, 1 mM individual dNTPs and 20 U of Ribolock Ribonuclease inhibitor in a final volume of 20 µl. The reaction was stopped by heating at 70 °C for 10 min. Four microliters of this reaction was then used as a template for the polymerase chain reaction, which was performed with 1 U of Taq polymerase in a final volume of 40 µl with specific oligos at a 0.4 µM final concentration. The annealing temperature was 54 °C. Five microliters samples were taken at 25, 29, 32 and 35 cycles to ensure that we were working within the semiquantitative range. The oligonucleotide sequences were as follows: SHP-1: forward oligo: AGGCCGGCTTCTGGGAGGAGTT; reverse oligo: CCAGTGGGGA GATCTGCAATGTTC. SHP-2: forward oligo: TGACCTCTATGGCGGGGAAAAGTT; reverse oligo: TCAGCGGCATTAATACGAGTTGTG. Product lengths were 400 and 486 pb for SHP-1 and SHP-2, respectively. 2.8. Myeloperoxidase (MPO) assay Excised pancreatic tissue samples were rinsed with saline, blotted dry, snapfrozen in liquid nitrogen, and stored at -80 °C. MPO activity was detected by using the MPO Fluorimetric Detection Kit following the manufacturer's instructions. 2.9. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting SHP-1 and SHP-2 were analysed by SDS-PAGE using 10% gels [28]. The proteins present in the gels were transferred to PVDF membranes. After blocking non-specific binding with 5% non-fat dry milk (dissolved in buffer 10 mM Tris–HCl, 100 mM NaCl, 0.1% Tween 20, pH 7.5), Western blots were probed with anti-SHP-1 or anti-SHP-2 monoclonal antibodies diluted 1:150 and 1:2500, respectively, in the blocking solution. 2.10. Statistical analysis Data are expressed as means ± SD. They were analysed using the non-parametric Mann–Whitney U test. 3. Results 3.1. SHP-1 and SHP-2 expression during the development of AP We considered it more appropriate to express the data in relation to the whole pancreas because pancreatitis is associated with the neutrophil infiltration and cell death that make the cell com- position of the pancreases of control or pancreatitic rats different. We observed an increase in the expression of both SHP-1 and SHP-2 in the early phase of AP (2 h after the first injection of Cer) (6.1 ± 2.4- and 3.3 ± 1.6-fold that of controls for SHP-1 and SHP-2, respectively). For SHP-1, this early increase in expression remained in the intermediate and later phases of AP, although to a lower extent (i.e., 3.0 ± 0.8-fold that of the control at 9 h). By contrast, SHP-2 expression fell to levels similar to those of the controls from 4 h onwards. The induction of AP by Cer resulted in an increase in SHP-1 and SHP-2 mRNAs in pancreas but not in a control organ with Cer receptors (brain), in which the expression of SHP-1 and SHP-2 proteins remained constant (data not shown). Cer-induced AP is thus associated with increases in pancreatic SHP-1 and SHP-2 at the level of both protein and mRNA. Additionally, as proof of the establishment of AP, a significant increase in serum amylase activity was observed along the development of AP. To analyse whether the increase in SHP-1 and SHP-2 protein expression was specific to the Cer AP model, we next assayed the taurocholate and BPDO models of AP. For this, the pancreases were studied once AP was fully developed. An increase in the expression of SHP-2 was also observed in the other two models of AP, mainly in the BPDO model (4.5 ± 1.4- and 11.9 ± 5.6-fold that of controls for the taurocholate and BPDO models, respectively). By contrast, an increase in SHP-1 protein expression was not detected either in the taurocholate or in the BPDO model of AP; instead, a decrease was observed, especially in the BPDO model. 3.2. Influence of neutrophil infiltration Neutrophil infiltration is an important component in the development of both inflammation and cell death in pancreatitis. Thus, in an attempt to see whether infiltrating neutrophils were responsible for, or could somehow influence, the increase in the protein expression of both PTPs in Cer-induced AP, rats were rendered neutropenic with vinblastine sulfate before treatment. The rats were administered vinblastine on day 1, and the experiment with Cer was conducted on day 5, at which point it has been reported that animals have no remaining neutrophils [26]. As expected, a differential count of leukocytes in the blood of the rats used in our experiments afforded zero percent of neutrophils (39 ± 5 and 0% neutrophils in blood from Cer-induced AP (4 h) rats non-pretreated or pretreated with vinblastine sulfate, respectively, n = 3 Furthermore, leukocyte accumulation in the pancreas was investigated by measuring MPO activity. We chose to study the intermediate phase of AP (4 h) because it has been reported that at this time the inflammatory cell infiltration has already taken place [30]. While Cer treatment (4 h) caused leukocyte accumulation in the pancreas, the administration of vinblastine resulted in blunted pancreatic MPO levels. With respect to serum amylase, vinblastine treatment alone did not affect its activity, and Cer treatment in vinblastine-treated rats did not decrease serum amylase levels. The depletion of neutrophils in the rats did not significantly affect the increase in SHP-1 protein expression at 4 h after Cer treatment (5.7 ± 1.8- and 3.6 ± 1.6-fold above the controls in pancreatitic rats non-pretreated or pretreated with vinblastine sulfate, respectively). In the case of SHP-2, neutrophil depletion prevented the decrease in PTP expression down to basal levels at 2 h after Cer treatment, because in the intermediate phase of AP (4 h) SHP-2 protein expression was still significantly increased (1.1 ± 0.1- and 4.1 ± 1.7-fold that of controls in pancreatitic rats non-pretreated or pretreated with vinblastine sulfate, respectively). 3.1. Effect of JNK and ERK1/2 kinase inhibition by SP600125 It has been proposed that MAP kinases play a pivotal role in the development of hyperstimulation-induced pancreatitis, in part due to an amelioration of the severity of Cer-induced AP after the inhibition of JNK and ERK1/2 kinases [9]. To check whether these two MAP kinases might play a role in the increase of the expression of both PTPs in the early phase (2 h) of AP, we next investigated the effect of SP600125, a new inhibitor of JNK and ERK1/2, on SHP-1 and SHP-2 protein expression. SP600125 pre-treatment did not reduce the increase in the expression of either PTP after Cer treatment. By contrast, the expression of both SHP-1 and SHP-2 was significantly in creased in the pancreases of Cer-injected rats pretreated with SP600125 in comparison with the non-pretreated animals (6.2 ± 1.6- and 3.1 ± 0.7-fold, and 7.1 ± 2.5- and 2.1 ± 1.1-fold as com pared with control rats for SHP-1 and SHP-2, respectively). Moreover, JNK and ERK1/2 inhibition in the absence of Cer stimulation was also able to increase SHP2 protein expression to a similar extent to Cer (2.6 ± 0.8- and 2.1 ± 1.1-, 2.3 ± 0.7-fold that of control rats injected with saline or saline+ vehicle (DMSO), for Cer and Cer+vehicle (DMSO) or saline+ SP600125 injected rats, respectively). This latter effect was not observed for SHP-1. Regarding serum amylase activity in the early phase (2 h) of AP, SP600125 was not able to reduce the significant increase observed in the animals given Cer alone (1603 ± 10, 1710 ± 56, 4800 ± 300, 5500 ± 400 U/l, n = 3, for rats given saline+DMSO, saline+SP600125, Cer+DMSO and Cer+SP600125, respectively, data not shown). 3.4. Effect of type IV phosphodiesterase inhibition by rolipram We next decided to analyse the role of cAMP levels in the increase in the expression of both PTPs in the early phase (2 h) of AP, since it has recently been proposed that intracellular cAMP levels in inflammatory cells might also play an essential role in the pathogenesis of AP [27]. it can be observed that rolipram, an inhibitor of type IV phosphodiesterase, did not affect the increase in SHP-1 protein expression due to Cer, since in comparison with the non-pretreated animals PTP protein expression was not modified in the pancreases obtained from Cer-injected rats pretreated with rolipram (4.9 ± 1.5 vs 6.6 ± 3.5-fold above control rats, respectively). Unlike SHP-1, the increase in SHP-2 protein expression due to Cer was significantly suppressed in rolipram-pretreated rats (1.3 ± 0.3 vs 5.0 ± 0.3-fold above control rats (injected with saline+vehicle) for Cer+rolipram and Cer+vehicle rats, respectively). Rolipram did not change SHP-2 protein expression in the absence of Cer stimulation [1.2 ± 0.1-fold in saline+ rolipram-injected rats as compared with saline+vehicle-injected rats]. Regarding serum amylase activity in the early phase (2 h) of AP, rolipram showed a tendency (although not significant) to reduce such activity in rats given Cer+rolipram (1450 ± 30, 1600 ± 50, 5500 ± 250 and 4700 ± 400 U/l, n = 3, for rats given saline+DMSO, saline+rolipram, Cer+DMSO and Cer+ rolipram, respectively, data not shown). 3.5. SHP-1 and SHP-2 subcellular distribution during the development of AP Finally we analysed the subcellular distribution and dynamics of both PTPs. As expected, both PTPs were completely or mainly cytosolic (located in the S fraction. SHP-1 remained as a cytosolic enzyme along the development of pancreatitis development and was never seen to become associated with any subcellular membrane-fraction. By contrast, we observed that in the early phase of AP (2 h), the increase in the expression of SHP-2 protein was associated with significant increases in its location in the L+M fraction, but mainly in the Mic subcellular fraction. This redistribution was less marked at 4 h after the first injection of Cer, and it disappeared at 9 h. 4. Discussion AP involves a complex cascade of local and systemic events that are initiated as a response to stress by the pancreatic acinar cell, but the cellular and molecular mechanisms responsible of the initiation of pancreatitis are not well understood. Acinar cell responses in AP include not only rapid protein activation by posttranslational modifications, but also alterations in gene and/ or protein expression that may convert the rapid activation of signalling mechanisms in acinar cells into long-term responses [1]. All these events, as a whole, will determine the ultimate severity of AP. It has been proposed that alterations in gene expression within the initiation phase of AP play an important role in its development [1]. Taking this into account, in this study we report an increase in SHP-1 and SHP-2 in the pancreas at the level of both protein and mRNA as an early event during the development of Cer-induced AP. Especially significant was the increase in the expression of SHP-2 protein, because it was observed commonly in all three different in vivo models of AP. This highlights the general importance of the increase in the expression of this PTP in AP. By contrast, the specificity of the increase in SHP-1 protein in the Cer-induced AP model could reflect a specific response to a specific insult. It is known that both SHP-1 and SHP-2 are expressed in the rat exocrine pancreas [12] and that both PTPs are scarcely detectable in human neutrophils [31], which, together with the data obtained here with vinblastine sulfate, indicates that the increase in the expression of both PTPs most likely arises from pancreatic acinar cells. Nevertheless, it is still possible that other minor pancreatic cell types could account for some of the observed changes. In this context, further studies are currently being designed to fully determine the cellular origins of these PTPs. It has been reported that there is a common set of genes expressed in at least Cer and taurocholate-induced AP [1], which suggests the possibility of a common set of upstream signalling mechanisms. From previous studies, it is known that the different AP models used here induce the activation of stress kinases, including JNK [32]. Both JNK and ERK1/2 have been proposed to be important mediators during the early phase (first 1–1.5 h) of AP [9,26,33]. Many of the transcription factors (TFs) induced early on in the onset of AP are known to be regulated by the activation of stress kinase pathways [1]. Thus, the activation of stress kinases provides a potential link between the earliest known signalling events in AP and the long-term consequences that stem from changes in gene expression. Furthermore, stress kinases also regulate protein translation [34]. Since these enzymes have been reported to promote gene and protein expression early on in the development of Cer-induced AP [9,26], we decided to analyse their potential influence in the observed increase of both SHP-1 and SHP-2 proteins. We used SP600125, a new MAPK inhibitor that, under the conditions used here, has been described to almost totally inhibit Cer-induced pancreatic JNK activation and partially inhibit ERK1/2 activation [9]. Our results demonstrated that SP600125 pre-treatment was able to positively modulate both SHP-1 and SHP-2 protein expression in the early phase of Cer-induced AP. Currently it is difficult to envisage the mechanism by which the inhibition of MAPK would afford further increases in both PTP proteins. It is possible that the observed effect could be mediated through an effect on the half-life of early-activated TFs. It has been proposed that the activation of TFs also facilitates their immediate degradation, thus ensuring the end of translation activation [35]. It is possible that an inhibition of the MAPK pathway that activates specific TFs might influence the concomitant degradation rate of such TFs, thus modifying their half-life. Another possibility would be an effect of JNK and/or ERK1/2 on the half-life of both SHP-1 or SHP-2 proteins or messages. Further specific research would be necessary to analyse this surprising effect. Considering that MAPKs have also been shown to upregulate the expression of inflammatory cytokines, such as TNF-a [9], which also primes cell infiltration in the pancreas, and that SP600125 pre-treatment results in a blunted leukocyte accumulation in the pancreases of Cer-induced AP rats [9], the positive effects of SP600125 and the data on neutropenic rats seem to be in good agreement. We believe that analyses of infiltration as a regulator of at least SHP-2 protein expression merit further investigation. The lack of a significant reduction in amylase activity after SP600125 pre-treatment seems to be in disagreement with previous results [9]. Nevertheless, it is important to recall that we were analysing the early phase of Cer-induced AP and that those previous results [9] were found in rats with fully developed AP. Therefore, the reduction in amylase activity after JNK and ERK1/2 inhibition would occur later on in the development of AP. Excessive ATP catabolism has been reported to occur during AP [20] and increases in cAMP levels in inflammatory cells by rolipram have been reported to attenuate some inflammatory diseases, including AP [27]. Rolipram is a specific and strong inhibitor of type IV phosphodiesterase, a key enzyme in the metabolism of intracellular cAMP that is abundantly expressed in inflammatory cells such as neutrophils and that also exerts anti-inflammatory effects by increasing the level of intracellular cAMP by blocking its catalysis. Thus, rolipram has a similar action to that of adenosine A2a receptors, a receptor type mainly expressed in inflammatory cells [10]. Increases in intracellular cAMP levels enhance the activity of cAMP-dependent protein kinase A and reduce the production of proinflammatory cytokines such as TNF-a [36]. Importantly, acinar cells can behave as true inflammatory cells, which also produce such proinflammatory cytokines [37]. Accordingly, although we are not aware of any report describing the presence of type IV phosphodiesterase in acinar cells, rolipram could be a useful tool for investigating the role of intracellular cAMP levels in cell infiltration, and probably also in acinar cells, during the development of AP. Accordingly, analysis of the putative influence of rolipram not only on infiltrating neutrophils but also on acinar cells as a cause of the specific sensitivity of SHP-2 expression to rolipram deserves further investigation. Future in vitro experiments with isolated acinar cells in the presence or absence of neutrophils will be necessary to further increase our understanding of the in vivo effect of rolipram on SHP-2 protein expression in Cer-induced AP rats. SHP-1 remained as a cytosolic enzyme during Cer-induced AP development (this work), which is in agreement with previous results [12]. By contrast, the increase in SHP-2 in the early phase of Cer-induced AP was associated with a redistribution of its subcellular location. Preliminary data with three different lysosomal populations obtained by centrifugation of the pancreatic L+M subcellular fraction in Percoll density gradients revealed that SHP-2 significantly increases its location by more than 100% (reaching up to 50% of total SHP-2 protein in the L+M fraction) in the two densest populations (unpublished results). Electron microscopic observations of these reveal that they are composed of vesicles enclosing membrane fragments and amorphous membrane-bound material of varying sizes and shapes. Data on the intracellular proteolytic systems used for PTP degradation are very scarce, although it is generally accepted that most regulatory molecules involved in highly regulated cellular processes such as signal transduction are substrates of the proteasome. Thus, the meaning of the association of SHP-2 with lysosomes in AP is unknown. Despite this, it should be noted that the lysosomal/vacuolar system is a discontinuous and heterogeneous digestive system that also includes structures that are devoid of hydrolases and that carry out processes of heterophagy and autophagy [38], and that autophagy has been reported to occur in AP [39]. It is possible that as a result of autophagy, membranous and/or non-membranous material carrying SHP-2 protein could reach the densest lysosomal populations. Moreover, SHP-2 protein was also increased in the Mic subcellular fraction. At this point it is not possible to know what this would be due to. One possibility is the recruitment of SHP-2 to the plasma membrane by activated receptor protein tyrosine kinases or other phosphotyrosine-containing ligands that occur early on in the development of AP [40]. It should be noticed that most of the plasma membrane would be present in the Mic fraction in our fractionation method. Finally, it is known that AP is associated with the disassembly of the acinar cell cytoskeleton [41] and several lines of in vitro and in vivo evidence suggest that SHP-2 might be involved in the control of cytoskeletal architecture [40]. In sum, in this study we have detected an increase in SHP-1 and SHP-2 in the pancreas at the level of both protein and mARN as an early event during the development of Cer-induced AP. The increase in SHP-2 protein (which was associated with changes in its subcellular distribution) in two other different in vivo pancreatitic models points towards the general importance of this phosphatase in AP. The inhibition of JNK and ERK1/2 further increased the expression of both SHP-1 and SHP-2 proteins, while the inhibition of type IV phosphodies- terase only suppressed the increase in SHP-2 protein expression in the early phase of AP. References [1] B. Ji, X. Chen, D.E. Misek, R. Kuick, S. Hanash, S. Ernst, R. Najarian, C.D. Logsdon, Pancreatic gene expression during the initiation of acute pancreatitis: identification of EGR-1 as a key regulator, Physiol. Genomics. 14 (2003) 59–72. [2] R. Alonso, A. Montero, M. Arévalo, L.J. García, C. Sánchez-Vicente, F. Rodríguez-Nodal, J.M. López-Novoa, J.J. Calvo, Platelet-activating factor mediates pancreatic function derangement in caerulein-induced pancreatitis in rats, Clin. Sci. 87 (1994) 85–90. [3] R. Pescador, M.A. Manso, A.J. Revollo, I. De Dios, Effect of chronic administration of hydrocortisone on the induction and evolution of acute pancreatitis induced by cerulein, Pancreas 11 (1995) 165–172. [4] N. Yönetçi, N. Oruç, A.O. Ozütemiz, H.A. Celik, G. Yüce, Effects of mast cell stabilization in caerulein-induced acute pancreatitis in rats, Int. J. Pancreatol. 29 (2001) 163–171. [5] M. Zhao, D.B. Xue, B. Zheng, W.H. Zhang, S.H. Pan, B. Sun, Induction of apoptosis by artemisin relieving the severity of inflammation in caerulein-induced acute pancreatitis, World J. Gastroenterol. 14 (2007) 5612–5617. [6] N. Rivard, G. Rydzewska, J.-S. Lods, J. Martinez, J. Morisset, Pancreas growth, tyrosine kinase, PtdIns 3-kinase, and PLD involve high-affinity CCK-receptor occupation, Am. J. Physiol. 266 (1994) G62–G70. [7] N. Rivard, G. Rydzewska, J.S. Lods, J. Morisset, Novel model of integration of signalling pathways in rat pancreatic acinar cells, Am. J. Physiol. 269 (1995) G352–G362. [8] C. Widmann, S. Gibson, M.B. Jarpe, G.L. Johnson, Mitogen activated protein kinases: conservation of a three kinase module from yeast to human, Physiol. Rev. 79 (1999) 143–180. [9] L. Minutoli, D. Altavilla, H. Marini, M. Passaniti, A. Bitto, P. Seminara, F.S. Venuti, C. Famulari, A. Macri, A. Versaci, F. Squadrito, Protective effects of SP600125 a new inhibitor of c-Jun N-terminal kinase (JNK) and extracellular-regulated kinase (ERK1/2) in an experimental model of cerulein-induced pancreatitis, Life Sci. 75 (2004) 2853–2866. [10] A. Satoh, T. Shimosegawa, K. Satoh, H. Ito, Y. Kohno, A. Masamune, M. Fujita, T. Toyota, Activation of A1-receptor pathway induces edema formation in the pancreas of rats, Gastroenterology 119 (2000) 829–836. [11] T. Sato, M. Otaka, M. Odashima, S. Kato, M. Jin, N. Konishi, T. Matsuhashi, S. Watanabe, Specific type IV phosphodiesterase inhibitor ameliorates cerulein-induced pancreatitis in rats, Biochem. Biophys. Res. Commun. 346 (2006) 339–344. [12] J. Schnekenburger, J. Mayerle, B. Krüger, I. Buchwalow, F.U. Weiss, E. Albrecht, V.E. Samoilova, W. Domschke, M.M. Lerch, Protein tyrosine phosphatase k and SHP-1 are involved in the regulation of cell–cell contacts at adherent junctions in the exocrine pancreas, Gut 54 (2005) 1445–1455. [13] M.M. Lerch, M.P. Lutz, H. Weidenbach, F. Muller-Pillasch, T.M. Gress, J. Leser, G. Adler, Dissociation and reassembly of adherent junctions during experimental acute pancreatitis, Gastroenterology 113 (1997) 1355–1366. [14] T. Muller, A. Choidas, E. Reichmann, A. Ullrich, Phosphorylation and free pool of beta-catenin are regulated by tyrosine kinases and tyrosine phosphatases during epithelial cell migration, J. Biol. Chem. 274 (1999) 10173–10183. [15] M. You, Z. Zhao, Positive effects of SH2 domain-containing tyrosine phosphatase SHP-1 on epidermal growth factor- and interferon-g-stimulated activation of STAT transcription factors in HeLa cells, J. Biol. Chem. 272 (1997) 23376–23381. [16] C.-K. Qu, Role of the SHP-2 tyrosine phosphatase in cytokine-induced signalling cellular response, Biochim. Biophys. Acta 1592 (2002) 297–301. [17] J. Den Hertog, A. Grogen, T. Van Der Wijk, Redox regulation of protein- tyrosine phosphatases, Arch. Biochem. Biophys. 434 (2005) 11–15. [18] A. Hernández-Hernández, J. Sánchez-Yagüe, E.M. Martín-Valmaseda, M. Llanillo, Oxidative inactivation of human and sheep platelet membrane-associated phosphotyrosine phosphatase activity, Free Radical Bio. Med. 26 (1999) 1218–1230. [19] A. Hernández-Hernández, M.N. Garabatos, M.C. Rodríguez, M.L. Vidal, A. López-Revuelta, J.I. Sánchez-Gallego, M. Llanillo, J. Sánchez-Yagüe, Structural characteristics of a lipid peroxidation product, trans-2-nonenal, that favour inhibition of membrane associated phosphotyrosine phosphatase activity, Biochim. Biophys. Acta 1726 (2005) 317–325. [20] R. Lüthen, C. Niedereau, J.H. Grendell, Intrapancreatic zymogen activation and levels of ATP and glutathione during cerulein pancreatitis in rats, Am. J. Physiol. 268 (1995) G592–G604. [21] C. Sánchez-Bernal, O.H. García-Morales, C. Domínguez, P. Martín-Gallán, J.J. Calvo, L. Ferreira, N. Pérez-González, Nitric oxide protects against pancreatic subcellular damage in acute pancreatitis, Pancreas 28 (2004) e9–e15. [22] H.J. Aho, S.M. Koskensalo, T.J. Nevalainen, Experimental pancreatitis in the rat. Sodium-taurocholate-induced acute haemorrhagic pancreatitis, Scand. J. Gastroenterol. 15 (1980) 411–416. [23] A. de la Mano, L.S. Sevillano, I. De Dios, S. Vicente, M. Manso, Low enzyme content in the pancreas does not reduce the severity of acute pancreatitis induced by bile-pancreatic duct obstruction, Moll. Cell. Biochem. 240 (2002) 75–81. [24] K. Lorentz, Approved recommendation of IFCC methods for the measurement of catalytic concentration of enzymes. Part 9. IFCC method for a-amylase (1,4-a-D-Glucan 4-Glucanohydrolase, EC 3.2.1.1), Clin. Chem. Lab. Med. 36 (1998) 185–203. [25] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [26] A.P. Clemons, D.M. Holstein, A. Galli, C. Saunders, Cerulein-induced acute pancreatitis in the rat is significantly ameliorated by treatment with MEK1/2 inhibitors U0126 and PD98059, Pancreas 25 (2002) 251–259. [27] T. Sato, M. Otaka, M. Odashima, S. Kato, M. Jin, N. Konishi, T. Matsuhashi, S. Watanabe, Specific type IV phosphodiesterase inhibitor ameliorates cerulein-induced pancreatitis in rats, Biochem. Biophys. Res. Commun. 346 (2006) 339–344. [28] A. Hernández-Hernández, M. Llanillo, M.C. Rodríguez, F. Gómez, J. Sánchez-Yagüe, Amphiphilic and hydrophilic nature of sheep and human platelet phosphotyrosine phosphatase forms, Biochim. Biophys. Acta 1419 (1999) 195–206. [29] A. Hernández-Hernández, M.C. Rodríguez, A. López-Revuelta, J.I. Sánchez-Gallego, V. Shnyrov, M. Llanillo, J. Sánchez-Yagüe, Alterations in erythrocyte membrane protein composition in advanced non-small cell lung cancer, Blood Cell Mol. Dis. 36 (2006) 355–363. [30] J. Mayerle, J. Schnekenburger, B. Kruger, J. Kellermann, M. Ruthenburger, F.U. Weiss, A. Nalli, W. Domschke, M.M. Lerch, Extracellular cleavage of E-cadherin by leukocyte elastase during acute experimental pancreatitis in rats, Gastroenterology 129 (2005) 1251–1267. [31] N. Tidow, B. Kasper, K. Welte, SH2-containing protein tyrosine phosphatases SHP-1 and SHP-2 are dramatically increased at the protein level in neutrophils from patients with severe congenital neutropenia (Kostmann's syndrome), Exp. Hematol. 27 (1999) 1038–1045. [32] M.L. Steer, A.K. Saluja, Experimental acute pancreatitis studies of the early events that lead to cell injury, in: V.L.W. Go, E.P. Di Magno, J.D. Gardner, E. Lebenthal, H.A. Rebar, G.A. Scheele (Eds.), The Pancreas: Biology, pathophysiology and Diseases, Raven, New York, 1993, pp. 489–499. [33] T. Hofken, N. Keller, F. Fleischer, B. Goke, A.C. Wagner, Map Kinase Phosphatases (MKP's) are early responsive genes during induction of cerulein hyperstimulation pancreatitis, Biochem. Biophys. Res. Commun. 276 (2000) 680–685. [34] J.A. Williams, Intracellular signalling mechanisms activated by cholecystokinin-regulating synthesis and secretion of digestive enzymes in pancreatic acinar cells, Ann. Rev. Physiol. 63 (2001) 77–97. [35] A. Hernández-Hernández, P. Ray, G. Litos, M. Ciro, S. Ottolenghi, H. Beug, J. Boyes, Acetylation and phosphorylation co-operate to target transcriptionally active GATA-1 for degradation, EMBO J. 25 (2006) 3264–3274. [36] J. Semmler, H. Wachtel, S. Endres, The specific type IV phosphodiesterase inhibitor rolipram suppresses tumor necrosis factor-a production by human mononuclear cells, Int. J. Immunopharmacol. 15 (1993) 409–413. [37] A.S. Gukovskaya, I. Gukovsky, V. Zaninovic, M. Song, D. Sandoval, S. Gukovsky, S.J. Pandol, Pancreatic acinar cells produce, release, and respond to tumor necrosis factor-alpha. Role in regulating cell death and pancreatitis, J. Clin. Invest. 100 (1997) 1853–1862. [38] A. Ciechanover, Intracellular protein degradation: from a vague idea thru the lysosome and the ubiquitin-proteasome system and onto human diseases and drug targeting, Hematology Am. Soc. Hematol. Educ. Program (2006) 1–12. [39] J.M. Grönroos, H.J. Aho, A.J. Hietaranta, T.J. Nevalainen, Early acinar cell changes in Cerulein-induced interstitial acute pancreatitis in the rat, Exp. Pathol. 41 (1991) 21–30. [40] G.S. Feng, Shp-2 tyrosine phosphatase: signalling one cell or many, Exp. Cell. Res. 253 (1999) 47–54. [41] J. Jungermann, M.M. Lerch, H. Weidenbach, M.P. Lutz, B. Krüger, G. Adler, Disassembly of rat pancreatic acinar cell cytoskeleton during supramaximal secretagogue stimulation, Am. J. Physiol. 268 (1995) G328–G338. (Pancreas 2010;39: 639-645) Rolipram and SP600125 Suppress the Early Increase in PTP1B Expression During Cerulein-Induced Pancreatitis in Rats Nancy Sarmiento, BSc,* Carmen Sánchez-Bernal, PhD,* Nieves Pérez, PhD,* José L. Sardina, BSc,* Arturo Mangas, PhD, José J. Calvo, PhD, and Jesús Sánchez-Yagüe, PhD* Objectives: To analyze the expression modulation of pancreatic protein tyrosine phosphatase (PTP)1B during the development of cerulein (Cer)-induced acute pancreatitis (AP) and the effect of inhibition of type 4 phosphodiesterase and c-Jun N-terminal kinase and extracellular signal-regulated kinase 1/2 on its expression levels. Methods: Acute pancreatitis was induced in rats by subcutaneous injections of 20 Kg Cer per kilogram body weight at hourly intervals, and the animals were killed at 2, 4, or 9 hours after the ¿rst injection. Neutropenia was induced with vinblastine sulfate. Phosphodiesterase and the mitogen-activated protein kinases were inhibited with rolipram and SP600125, respectively, before the induction of AP. Results: Protein tyrosine phosphatase 1B increases its expression at the levels of both protein and messenger RNA during the early phase of Cer-induced AP. The increase in protein expression persisted along the development of the disease, and neutrophil in¿ltration seemed to play a central role. Rolipram and SP600125 pretreatments mostly suppressed the increase in the expression of PTP1B during the early phase of AP. Conclusions: Cerulein-induced AP is associated with an increase in the expression of PTP1B in its early phase. An increase in cyclic adenosine monophosphate levels in in¿ammatory cells and the inhibition of c-Jun N-terminal kinase and extracellular signal-regulated kinase 1/2 are able to suppress the increase in PTP1B protein level. Key Words: PTP1B, acute pancreatitis, cerulein, SP600125, rolipram (Pancreas 2010;39: 639-645) One of the animal models of human edematous pancreatitis is that induced in the rat by cerulein (Cer), an analog of cholecystokinin (CCK). The subcutaneous injection of 20 Kg Cer per kilogram body weight, the treatment used for the induction of acute pancreatitis (AP) in the present studies, results in the manifestations of pancreatitis, including different indicators of morphological and histological damage to the pancreas, interstitial edema, and hyperamylasemia as well as neutrophil in¿ltration.1-4 It is reasonable to assume that the development of pancreatitis would be based on rapid early events and the activation of primary signaling pathways, whose unmasking would be important for the study of AP at the molecular level.5 With respect to the Cer-induced AP model, the intracellular mechanisms by which CCK or Cer regulates pancreatic acinar function are complex. Within the signaling mechanisms that play important roles in the regulation of many cellular functions, those that are controlled by tyrosine phosphorylation are particularly important. It is well known that in Cer-induced AP, different signaling routes that modulate the phosphorylation state of proteins are activated: (1) pancreatic protein tyrosine kinases (PTKs),6,7 (2) the mitogen-activated protein kinase (MAPK) cascade, especially extracellular signal-regulated kinase (ERK1/2) and c-Jun N-terminal kinase (JNK),8,9 (3) p38MAPK, (4) the adenosine A1 receptor pathway,10 which decreases intracellular cyclic adenosine monophosphate (cAMP) levels. It is also known that type 4 phosphodiesterase inhibitors ameliorate Cer-induced AP.11 Unlike the case of PTKs, data on protein tyrosine phosphatases (PTPs) in AP are very scarce despite (1) their roles in the regulation of the levels of tyrosine phosphorylation in exocytotic processes in exocrine pancreatic acinar cells12 and in different in¿ammatory diseases and (2) their inactivation by reactive oxygen species or secondary products of oxidation13 that may form during the development of AP.14 This association between PTPs and diseases calls for an examination of PTP expression modulation and their corresponding function, and, in the case of AP, it is strengthened by the demonstration of PTP1B as a key controller of several cytokine signaling pathways through their negative action on speci¿c members of the Janus kinases/signal transducers and activators of transcription (JAK/STAT) pathway.15 JAK2/STAT3 in¿ammatory signaling has been implicated in AP,16 and JAK2 is a target of PTP1B.16 PTP1B also plays important roles in cells with a high endoplasmic reticulum (ER) content,15 such as pancreatic acinar cells, which have the highest rate of protein synthesis among all human tissues.17 In fact, acinar cells seem to be susceptible to ER homeostasis, and all major ER stress-sensing and signaling mechanisms have been shown to be activated in AP.5,18,19 In addition, we have recently demonstrated that the Src homology 2 (SH2)-domain PTPs, SHP-1 and SHP-2, are early responsive elements in AP and that their expression increases in the early phase of Cer-induced AP.20 The goal of the present work was to study the expression response of a member of the subfamily of intracellular PTPs, the PTP1B, during the development of Cer-induced AP as well as the effect of rolipram, a type 4 phosphodiesterase inhibitor, and SP600125, a JNK and ERK 1/2 inhibitor, on PTP1B expression levels in the early phase of AP development. We developed this research in view of the importance of unmasking the molecules or genes whose expression changes in the early phase of AP development, together with the signaling mechanisms that may modulate such expression. MATERIALS AND METHODS Experiments were performed in male Wistar rats weighing 250 to 280 g, obtained from the University of Salamanca breeding colony. Animals were fasted overnight before the experiment but had free access to water. Care was provided in accordance with the procedures outlined in the European Community guidelines on ethical animal research (86/609/EEC), and protocols were approved by the Animal Care Committee of the University of Salamanca. Acute pancreatitis was induced as described previously.20 Brie¿y, rats received 4 subcutaneous injections of 20 Kg Cer per kilogram body weight or its vehicle (0.9% NaCl) at hourly intervals. At 2, 4, or 9 hours after the ¿rst injection, the animals were killed by cervical dislocation. The pancreata were rapidly harvested and used immediately for experiments. After dissection and homogenization of the pancreata,20 postnuclear homogenates were obtained to minimize the putative cross-reactivity of the PTP1B antibody with T cell protein tyrosine phosphatases (TC-PTP), the other member of the non-transmembrane 1 sub-family of intracellular PTPs. Although TC-PTP has not been reported to be present in rat pancreas, it has been described to be expressed in many organs of the mouse as a nuclear 45-kd form. In cell lines derived from a hamster glucagonoma, no TC-PTP protein or messenger RNA (mRNA) was detected.21 Serum amylase was measured in a Roche modular analyzer (Roche Diagnostics España, Barcelona, Spain) as reported pre- viously.20 Protein concentrations were assayed by the method of Bradford22 using bovine serum albumin as the standard. Histological Assessment of Pancreatitis For light microscopy, small pieces of the pancreas were rapidly removed at different times (2, 4, and 9 hours) after the induction of AP and ¿xed in 4% paraformaldehyde in 0.15-mol/L phosphate-buffered saline (pH 7.2) for 48 hours at 4-C. Subsequently, they were dehydrated in ascending concentrations of ethanol (50%-100%), rinsed in xylene, and then embedded in paraf¿n. Sections (10 Km thick) were mounted on gelatin-coated slides, deparaf¿nized, hydrated, and stained with hematoxylin and eosin (H & E). Induction of Neutropenia Neutropenia was induced in rats by an intravenous injection of vinblastine sulfate at a dose of 0.75 mg/kg on day 1, as previously described.20,23 At this dose, the animals become neutropenic between days 4 and 6.23 Five days after the induction of neutropenia, the animals were treated with 2 hourly injected doses of Cer (20 Kg Cer per kilogram) to induce AP. Inhibition of Type 4 Phosphodiesterase by Rolipram or of JNK and ERK1/2 by SP600125 in Cer-Induced AP Rats received intraperitoneal injections of rolipram (5 mg/ kg), SP600125 (15 mg/kg) or its vehicle (1 mL/kg of a 10% dimethyl sulphoxide/NaCl solution) both 30 minutes before and 30 minutes after, or both 2 hours before and 30 minutes after, the ¿rst Cer injections of rolipram11,20 and SP600125,9,20 respectively. Thirty minutes or 2 hours after the ¿rst injection of rolipram or SP600125, respectively, the rats were injected sub- cutaneously with Cer (20 Kg Cer per kilogram) or its vehicle (0.9% NaCl) at hourly intervals. The animals were killed 2 hours after the ¿rst Cer injection (early phase of Cer-induced AP). RT-PCR Assays Total RNA was isolated from the pancreas and the brain of the same rat by immediate solubilization in Trizol reagent and isopropanol puri¿cation. Reverse transcriptase polymerase chain reaction was performed in a total volume of 20 KL containing 2 Kg complementary DNA, 50-mmol/L Tris-HCl, pH 8.3, 50-mmol/L KCl, 4-mmol/L MgCl2, 10-mmol/L dithiothreitol, 1-mmol/L deoxynucleoside triphosphates, 0.5 Kmol/L of each primer, 20 units of Ribolock ribonuclease inhibitor, and 200 U RevertAid M-MuLV reverse transcriptase. The PTP1B oligonucleotide sequences were as follows: forward oligo, 5’- CTCACCCAGGGCCCTTTACCAA-3’; reverse oligo, 5-TGGATGAGCCCCATGCGGAACC-3. The product length was 539 bp. Oligonucleotide primers for ß-actin were used as an internal control (forward oligo, 5’-TCTGTGTGGATTGGTGGCTCTA-3’; reverse oligo, 5’-CTGCTTGCTGATCCACATCTG-3’). Cycle steps were performed as previously described.20 SDS-PAGE and Western Blotting Proteins were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis using 10% gels24 and then transferred to polyvinylidene di¿uoride membranes. Western blots were probed with anti-PTP1B polyclonal or anti-ß-tubulin monoclonal antibodies diluted 1:1000 and 1:4000, respectively. Blots were visualized by chemiluminescence. Analyses of the spots on all the blots were performed as described previously.25 RESULTS Increases in the Expression of PTP1B in AP The expression of PTP1B protein in whole postnuclear pancreatic homogenates increased during the development of AP. The bar diagram indicates quantitative data related to the whole pancreas. We considered it more appropriate or even necessary to express the data in relation to the whole pancreas because pancreatitis is associated with the neutrophil in¿ltration and cell death that render the cell composition of the pancreata of the rats in the control group or the pancreatitic rats different. Accordingly, the total amount of proteins per pancreas changes with treatment, and the exact amount of any protein, including PTP1B, should be calculated in the whole organ rather than in a ¿xed amount of proteins. We observed an increase in the expression of PTP1B in the early phase of AP (2 hours after the ¿rst injection of Cer; 4.1 ± 0.8-fold that of the controls) that remained in the intermediate and later phases of AP, although to a lower extent (ie, 2.3 ± 0.7-fold that of the control at 9 hours). The establishment of AP was monitored by serum amylase determination and the histological assessment as follows: (1) a signi¿cant increase in the serum amylase activity was observed along with the development of AP, and (2) histological sections of the pancreata from the control and the 2-, 4-, and 9-hour pancreatitic rats showed clear differences concerning tissue architecture and the degree of leukocyte in¿ltration. In the control animals, the pancreatic tissue showed normal acini, and no in¿ltration was observed. In the 2-hour pancreatitic rats, small numbers of unstructured acini and scarce lymphocytes were observed outside the vessels. In the 4-hour pancreatitic rats, a higher degree of leukocyte in¿ltration was visualized, and higher numbers of unstructured acini were also found. In addition, neutrophils were detected. Finally, in the 9-hour pancreatitic rats, a higher degree of tissue disorganization was seen, and numerous leukocytes were observed outside the vessels surrounding the acini and also adhering to the vascular endothelium. All these features are consistent with those described previously.1,3,4 Moreover, in the early phase of AP (2 hours), PTP1B mRNA increased in pancreas but not in a control organ with Cer receptors in which the expression of the PTP1B protein remained constant. A similar type of behavior has been reported for SHP-1 and SHP-2, the SH2 domain-containing PTPs.20 The edematous Cer-induced AP is thus associated with increases in pancreatic PTP1B at the level of both protein and mRNA. In¿uence of Neutrophil In¿ltration Neutrophil in¿ltration is an important component in the development of both in¿ammation and cell death in pancreatitis. We chose to study the intermediate phase of AP (4 hours) because it has been reported that at this time, in¿ammatory cell in¿ltration has already started or taken place,26 as shown in our AP model. As expected, neutropenia was associated with the disappearance of neutrophils from the blood: 39% - 5% and 0% neutrophils in a differential leukocyte count in the blood from Cer-induced AP (4 hours) rats not pretreated or pretreated with vinblastine sulfate, respectively; n = 3. We have previously reported that under the same conditions described here, the Cer treatment (4 hours) caused leukocyte accumulation in the pancreas,20 whereas the administration of vinblastine resulted in blunted pancreatic myeloperoxidase levels,20 pointing to the subsequent depletion in situ of neutrophil in¿ltration after the vinblastine treatment. The depletion of neutrophils in the rats suppressed the increase in PTP1B protein expression at 4 hours after the Cer treatment. Effect of Rolipram Pretreatment on PTP1B Expression Based on the aforementioned data obtained on the neutropenic rats, we next analyzed the role of cAMP levels in the increase in the expression of PTP1B in the early phase (2 hours) of AP. This was because it has recently been proposed that intracellular cAMP levels in neutrophils might play an essential role in the pathogenesis of AP because increases in such levels due to rolipram administration attenuate in¿ammatory diseases including AP.11 The increase in the PTP1B protein expression due to Cer was suppressed in the rolipram-pretreated rats: 1.0 ± 0.2-fold versus 2.8 ± 0.5-fold higher than that of the control rats (injected with saline+vehicle) for the Cer+rolipram and Cer+vehicle rats, respectively. Rolipram did not change the PTP1B protein expression in the absence of Cer stimulation (1.1 ± 0.3-fold in the saline+rolipram-injected rats compared with the saline+vehicle-injected rats). On the other hand, rolipram showed a tendency (although not signi¿cant) to reduce the serum amylase activity in the rats given Cer+rolipram. Effect of SP600125 Pretreatment on PTP1B Expression The observation that the severity of the Cer-induced AP was ameliorated after the inhibition of the JNK and ERK1/2 kinases9 points toward the major role of MAPKs in the development of hyperstimulation-induced pancreatitis. Accordingly, we next investigated whether these 2 MAPKs might play a role in the increase of the expression of PTP1B in the early phase (2 hours) of AP by using SP600125. SP600125 pretreatment reduced the increase in the expression of PTP1B after the Cer treatment: 2.9 ± 0.8- and 1.5 ± 0.3-fold compared with control rats (sal+ vehicle-injected rats) for the Cer+vehicle (dimethyl sulphoxide)-or Cer+SP600125-injected rats, respectively. There was no signi¿cant effect on the expression of PTP1B in the absence of Cer stimulation (0.9 ± 0.3-fold for Sal+SP600125-injected rats compared with control rats). In addition, SP600125 was not able to reduce the signi¿cant increase in the serum amylase activity observed in the animals given Cer alone, as reported elsewhere.20 DISCUSSION It has been proposed that alterations in gene and/or protein expression within the initiation phase of AP play an important role in its development because such changes might convert the rapid activation of signaling pathways in acinar cells into long-term responses.1 Taking this into account, in this study, we report an increase in PTP1B in the pancreas at the levels of both protein and mRNA as an early event during the development of the Cer-induced AP, a model that closely mimics clinically relevant AP re¿ecting a relatively mild edematous pancreatitis. The data obtained on the neutropenic rats seem to indicate a central role of neutrophil in¿ltration as a regulator of the PTP1B protein expression because the increase in the expression of PTP1B was not detected in the rats treated with vinblastine sulfate. To further investigate the role of in¿ltration, we treated rats with rolipram, a strong speci¿c inhibitor of type 4 phosphodiesterase, which is a key enzyme in the metabolism of intracellular cAMP that is abundantly expressed in in¿ammatory cells such as neutrophils and that also exerts anti-in¿ammatory effects, probably mediated by the inhibition of diverse leukocyte functions, ie, the production/secretion of proin¿ammatory cytokines such as tumor necrosis factor-a.27 Our data support a role for the neutrophil cAMP signaling pathway as a regulator of the PTP1B protein expression in the Cer-induced AP. They are also in accordance with a previous work describing a suppression of in¿ammatory cell in¿ltration in the pancreas of rats pretreated with rolipram before Cer administration.11 A more complex scenario could be considered if acinar cells can behave as true in¿ammatory cells, also producing proin¿ammatory cytokines.28 Accordingly, rolipram might also have an effect in acinar cells. This possibility deserves further investigation, and steps are currently being taken in our laboratory to check whether type 4 phosphodiesterase is present also in acinar cells. The activation of stress kinases, including JNK and ERK1/2, regulates transcription factors and promotes gene and protein expressions during the early phase (the ¿rst 0.5-3 hours) of the Cer-induced AP,1,9,23,29 thus providing a potential link between the earliest known signaling events in AP and the long-term consequences that stem from changes in gene expression. Therefore, we used the stress kinase inhibitor SP600125 to analyze their potential in¿uence in the observed increase in PTP1B protein. SP600125, under the conditions used here, has been described to almost totally inhibit Cer-induced pancreatic JNK activation and partially inhibit ERK1/2 activation.9 The underlying mechanism must be complex because SP600125 could target not only pancreatic kinases but also the JNK and ERK1/2 of the in¿ltrating netrophils, similar to the mitogen-activated protein kinase/ extracellular signal-regulated kinase kinase inhibition by U0126 and PD98059 in the Cer-induced AP described previously.23 Considering that MAPKs have also been shown to up-regulate the expression of in¿ammatory cytokines such as tumor necrosis factor-a,9 which also primes cell in¿ltration in the pancreas, and that SP600125 pretreatment results in a blunted leukocyte accumulation in the pancreata of the Cer-induced AP rats,9 the effects of SP600125 together with the data on neutropenic rats on PTP1B protein expression in the Cer-induced AP seem to be in good agreement. A link between cAMP and MAPK can be suggested from studies addressing the role of cAMP signaling in the regulation of cell cycle survival of human pancreatic cells. In this system, it has been demonstrated that increasing cAMP levels inhibits ERK cascade.30 It can therefore be proposed that regardless of whether rolipram and SP600125 target acinar cells, neutrophils, or both cell types, the results obtained with both inhibitors should probably be similar as indeed shown in the present work. Regarding the amylase activity, the ¿ndings of this work and those of a previous one20 support the notion that the observed reduction in such activity after JNK and ERK1/2 inhibition9 would not occur during the early phase of AP but later in its development. In summary, in this study, we have detected for the ¿rst time an increase in PTP1B in the pancreas, at the level of both protein and mRNA, as an early event during the development of Cer- induced AP in which neutrophil in¿ltration seems to play an important role. The increase in PTP1B protein expression in the early phase of AP was mostly prevented by type 4 phosphodiesterase and JNK and ERK1/2 inhibition. REFERENCES 1. Alonso R, Montero A, Arévalo M, et al. Platelet-activating factor mediates pancreatic function derangement in caerulein-induced pancreatitis in rats. Clin Sci. 1994;87:85-90. 2 Pescador R, Manso MA, Revollo AJ, et al. Effect of chronic administration of hydrocortisone on the induction and evolution of acute pancreatitis induced by cerulean. Pancreas. 1995;11:165-172. 3. Yöneti N, Oruç N, Ozütemiz AO, et al. Effects of mast-cell stabilization in caerulein-induced acute pancreatitis in rats. Int J Pancreatol. 2001; 29:163-171. 4. Zhao M, Xue DB, Zheng B, et al. Induction of apoptosis by artemisin relieving the severity of inflammation in caerulein-induced acute pancreatitis. World J Gastroenterol. 2007;14:5612-5617. 5. Ji B, Chen X, Misek DE, et al. Pancreatic gene expression during the initiation of acute pancreatitis: identification of EGR-1 as a key regulator. Physiol Genomics. 2003;14:59-72. 6. Rivard N, Rydzewska G, Lods JS, et al. Pancreas growth, tyrosine kinase, PtdIns 3-kinase, and PLD involve high-affinity CCK-receptor occupation. Am J Physiol. 1994;266:G62-G70. 7. Rivard N, Rydzewska G, Lods JS, et al. Novel model of integration of signalling pathways in rat pancreatic acinar cells. Am J Physiol. 1995;269:G352-G362. 8. Widmann C, Gibson S, Jarpe MB, et al. Mitogen activated protein kinases: conservation of a three kinase module from yeast to human. Physiol Rev. 1999;79:143-180. 9. Minutoli L, Altavilla D, Marini H, et al. Protective effects of SP600125 a new inhibitor of c-Jun N-terminal kinase (JNK) and extracellular-regulated kinase (ERK1/2) in an experimental model of cerulein-induced pancreatitis. Life Sci. 2004;75:2853-2866. 10. Satoh A, Shimosegawa T, Satoh K, et al. Activation of A1-receptor pathway induces edema formation in the pancreas of rats. Gastroenterology. 2000;119:829-836. 11. Sato T, Otaka M, Odashima M, et al. Specific type IV phosphodiesterase inhibitor ameliorates cerulein-induced pancreatitis in rats. Biochem Biophys Res Commun. 2006;346:339-344. 12. Feick P, Gilhaus S, Blum IR, et al. Inhibition of amylase secretion from differentiated AR4-2J pancreatic acinar cells by an actin cytoskeleton controlled protein tyrosine phosphatase activity. FEBS Lett. 1999;451:269-274. 13. Hernández-Hernández A, Garabatos MN, Rodríguez MC, et al. Structural characteristics of a lipid peroxidation product, trans-2-nonenal, that favour inhibition of membrane associated phosphotyrosine phosphatase activity. Biochim Biophys Acta. 2005;1726:317-325. 14. Sánchez-Bernal C, García-Morales OH, Domínguez C, et al. Nitric oxide protects against pancreatic subcellular damage in acute pancreatitis. Pancreas. 2004;28:e9-e15. 15. Bourdeau A, Dubé N, Tremblay ML. Cytoplasmic protein tyrosine phosphatases, regulation and function: the roles of PTP1B and TC-PTP. Curr Opin Cell Biol. 2005;17:203-209. 16. Yu J-H, Kim K-H, Kim H. SOCS 3 and PPAR-F ligands inhibit the expression of IL-6 and TGF-ß1 by regulating JAK2/STAT3 signalling in pancreas. Int J Biochem Cell Biol. 2008;40:677-688. 17. Case RM. Synthesis, intracellular transport and discharge of exportable proteins in the pancreatic acinar cell and other cells. Biol Rev Camb Philos Soc. 1978;53:211-354. 18. Kubish CH, Sans MD, Arumugan T, et al. Early activation of endoplasmic reticulum stress is associated with arginine-induced acute pancreatitis. Am J Physiol Gastrointest Liver Physiol. 2006;291: G238-G245. 19. Suyama K, Ohmuraya M, Hirota M, et al. C/EBP homologous protein is crucial for the acceleration of experimental pancreatitis. Biochem Biophys Res Commun. 2008;267:176-182. 20. Sarmiento N, Sánchez-Bernal C, Ayra M, et al. Changes in the expression and dynamics of SHP-1 and SHP-2 during cerulein-induced acute pancreatitis in rats. Biochim Biophys Acta. 2008;1782:271-279. 21. Wimmer M, Tag C, Schreimer D, et al. Protein tyrosine phosphatase 1B is located with glucagon vesicles, and its concentration is inversely correlated with the rate of glucagon secretion of INR1G9 cells. J Endocrinol. 2004;181:437-447. 22. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248-254. 23. Clemons AP, Holstein DM, Galli A, et al. Cerulein-induced acute pancreatitis in the rat is significantly ameliorated by treatment with MEK1/2 inhibitors U0126 and PD98059. Pancreas. 2002;25:251-259. 24. Hernández-Hernández A, Llanillo M, Rodríguez MC, et al. Amphiphilic and hydrophilic nature of sheep and human platelet phosphotyrosine phosphatase forms. Biochim Biophys Acta. 1999; 1419:195-206. 25. Hernández-Hernández A, Rodríguez MC, López-Revuelta A, et al. Alterations in erythrocyte membrane protein composition in advanced non-small cell lung cancer. Blood Cell Mol Dis. 2006;36:355-363. 26. Mayerle J, Schnekenburger J, Kruger B, et al. Extracellular cleavage of E-cadherin by leukocyte elastase during acute experimental pancreatitis in rats. Gastroenterology. 2005;129:1251-1267. 27. Semmler J, Wachtel H, Endres S. The specific type IV phosphodiesterase inhibitor rolipram suppresses tumor necrosis factor-> production by human mononuclear cells. Int J Immunopharmacol. 1993;15:409-413. 28. Gukovskaya AS, Gukovsky I, Zaninovic V, et al. Pancreatic acinar cells produce, release, and respond to tumor necrosis factor-alpha. Role in regulating cell death and pancreatitis. J Clin Invest. 1997;100: 1853-1862. 29. Hofken T, Keller N, Fleischer F, et al. Map kinase phosphatases (MKPs) are early responsive genes during induction of cerulein hyperstimulation pancreatitis. Biochem Biophys Res Commun. 2000; 276:680-685. 30. Boucher MJ, Duchesne C, Lainé J, et al. cAMP protection of pancreatic cancer cells against apoptosis induced by ERK inhibition. Biochem Biophys Res Commun. 2001;285:207-216. Digestive and Liver Disease 43 (2011) 132–138 Liver, Pancreas and Biliary Tract Changes in the morphology and lability of lysosomal subpopulations in caerulein-induced acute pancreatitis* Nancy Sarmientoa, Jesús Sánchez-Yagüea, Pedro P. Juanesa, Nieves Péreza, Laura Ferreirab, Violeta García-Hernándeza, Arturo Mangasc, José J. Calvod, Carmen Sánchez-Bernala,* Background and aims: Lysosomes play an important role in acute pancreatitis (AP). Here we developed a method for the isolation of lysosome subpopulations from rat pancreas and assessed the stability of lysosomal membranes. Methods: AP was induced by four subcutaneous injections of 20 µ,g caerulein/kg body weight at hourly intervals. The animals were killed 9 h after the ¿rst injection. Marker enzymes [N-acetyl-ß-D- glucosaminidase (NAG), cathepsin B and succinate dehydrogenase (SDH)] were assayed in subcellular fractions from control pancreas and in pancreatitis. Lysosomal subpopulations were separated by Per- coll density gradient centrifugation and observed by electron microscopy. NAG molecular forms were determined by DEAE-cellulose chromatography. Results: AP was associated with: (i) increases in the speci¿c activity of lysosomal enzymes in the soluble fraction, (ii) changes in the size and alterations in the morphology of the organelles from the lysosomal subpopulations, (iii) the appearance of large vacuoles in the primary and secondary lysosome subpopula- tions, (iv) the increase in the amount of the NAG form associated with the pancreatic lysosomal membrane as well as its release towards the soluble fraction. Conclusions: Lysosome subpopulations are separated by a combination of differential and Percoll density gradient centrifugations. Primary lysosome membrane stability decreases in AP. © 2010 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved. 1. Introduction Acute pancreatitis (AP) is an in¿ammatory disorder of the pancreas that can sometimes be lethal and that has a steadily increasing incidence [1]. In the caerulein (Cer)-induced model of mild pancreatitis intra-acinar zymogen activation plays an essential role [2]. Early on in the course of AP, lysosomal hydrolases colocalize with digestive zymogens, activating them [3–7] and causing acinar cell injury and necrosis [4,8]. However, it has not been totally elucidated how hydrolases and zymogen meet each other. Lysosomes are the site of degradation of both the extracellular macromolecules introduced by endocytosis and phagocytosis, and intracellular material by autophagy mechanisms [9–11]. In fact, autophagy accelerates trypsinogen activation by lysosomal hydrolases under acidic conditions, thus triggering AP in its early stage [12]. A decrease in the stability of the lysosomes in AP has also been proposed [4,13–15]. N-acetyl-ß-D-glucosaminidase (NAG, EC 3.2.1.30) is a lysosomal hydrolase that exists in two major isoforms: A and B. These enzyme forms were ¿rst described by Robinson and Stirling [16] and are characterized by their acidic optimum pH, their different pI and their thermostability. NAG is a marker enzyme for lysosomes, but while the B form is bound to the lysosomal membrane, the A form remains soluble inside the organelle. Although variations in total NAG activity in the pancreas have been described previously in different experimental models of AP [14,15,17], the molecular forms of this enzyme have not been analyzed, and neither have the isolation and analysis of the pancreatic lysosome (sub)population(s) been carried out in AP, in spite of their role in the disease. Accordingly, the purpose of the present study was: (1) to develop a procedure for the separation of different subpopulations of rat pancreatic lysosomes, checking their changes in AP by electron microscopy; (2) to assess, by ion-exchange chromatography of the molecular forms of NAG, the stability of the pancreatic lysosomal membranes in AP. 2. Materials and methods 2.1. Animals Male Wistar rats (weighing 250–280 g) were housed in rooms maintained at 22 ± 1 ¿C using a 12-h light/dark cycle. Animals were fasted 24 h before the experiment but had free access to water. Care was provided in accordance with the procedures outlined in European Community guidelines on ethical animal research (86/609/EEC), and the protocols were approved by the Animal Care Committee of the University of Salamanca. 2.2. Induction and histological assessment of AP, and sample preparation AP was induced as previously described [18,19]. Brie¿y, rats received four subcutaneous injections of 20 µ,g of Cer/kg body weight at hourly intervals. Nine hours after the ¿rst injection, the animals were killed by cervical dislocation. Control rats were injected with equivalent volumes of saline. AP was assessed by light microscopy (haematoxylin and eosin staining) as reported previously [19]. Whole pancreata were obtained immediately after the rats had been killed. Pancreata were dissected from the surrounding fat tissue and a small portion of them was used for haematoxylin and eosin staining [19]. The remaining parts of the pancreata were homogenized with a Potter Elvehjem device in 10 volumes (w/v) of homogenization buffer (3 mM imidazole buffer, pH 7.4 containing 0.25 M sucrose, 1 mM EDTA and 100 µ,g/ml trypsin inhibitor). In order to have enough material to achieve each aims of the research, 4 pancreata corresponding to 4 control or 4 pancreatitic animals, respectively, were homogenized together in each experiment. Then, subcellular fractionation was carried out in the postnuclear homogenate following a method in which lysosomes were coprecipitated with mitochondria at 20,000 × g after separation of the zymogen fraction at 1300 × g, as described previously by us [18,20]. Four subcellular fractions were obtained: the zymogen (Z), the lysosome plus mitochondria (L + M), the microsome (Mic) and the soluble (S) fractions. NAG, cathepsin B and succinate dehydrogenase (SDH) were determined in all four subcellular fractions isolated. Data from 7 independent experiments (n = 7) were used for the characterization of the subcellular fractions from pancreas and the lysosomal subpopulations, electron microscopy and ionic exchange chromatography, respectively. Detergent analysis and the determination of NAG thermal stability was performed in 5 independent experiments (n = 5). 2.3. Biochemical assays NAG was assayed by mixing 50 µl of a suitably diluted sample with 100 µ,l of the appropriate 3 mM 4-methylumbelliferyl substrate in 0.1 M sodium citrate buffer, pH 4.5. After 30 min at 37 ¿C, the reaction was stopped and ¿uorescence was developed by the addition of 2 ml of 0.5 M glycine – NaOH buffer, pH 10.4. The 4-methylumbelliferone ¿uorescence released was measured using a spectro¿uorimeter at 465 nm (excitation at 340 nm). The spectro¿uorimeter was calibrated with freshly prepared 4- methylumbelliferone in 0.5 M glycine–NaOH buffer, pH 10.4. One unit of enzyme activity (U) was de¿ned as nmol of methylumbelliferone released/h under the assay conditions. Cathepsin B (EC 3.4.22.1) was assayed according to Mc Donald and Ellis [21], with CB-ala-arg-arg-4-methoxy-ß-naphthylamide as a substrate at 20 ¿C. SDH (EC 1.3.99.1) was determined spectrophotometrically, following the method described by Pennington [22]. Serum amylase was measured as reported previously [18,19]. Protein concentrations were assayed according to Marxwell et al. [23], using bovine serum albumin as the standard. 2.4. Percoll gradient Aliquots (0.5 ml) of the L + M fractions diluted three times with homogenization buffer were layered on top of discontinuous gradients consisting of three layers of isotonic 17%, 10% and 5% Percoll solutions (3.8 ml each) prepared in homogenization buffer and placed from the bottom of the tube upwards, respectively. The density partial-gradients were then formed by centrifugation at 50,500 × g for 30 min in a Beckman SW40 rotor. Aliquots of 0.5 ml were collected from the top of the gradient tube with a Pasteur pipette and assayed for NAG and SDH activities. The aliquots showing the peak of the major NAG activity of the gradient were pooled, dialyzed and used for DEAE-cellulose chromatography. For the calibration of the Percoll density gradients, density marker beads were used, following the manufacturer’s instructions. For electron microscopy, three bands of organelles were recovered close to the interfaces of the density gradients. Each band was collected with a Pasteur pipette, diluted with homogenization buffer and washed by centrifugation at 50,000 × g for 15 min to remove the Percoll reagent. The organelles, which were located above the Percoll pellet, were ¿nally transferred to Eppendorf tubes and used immediately for electron microscopy. 2.5. Electron microscopy The organelles were washed in ice-cold 0.1 M sodium phosphate buffer, pH 7.4, containing 6.8% sucrose and 1% CaCl2 (buffer A) and were then ¿xed in 5% glutaraldehyde in buffer A. Following this, the samples were suspended in agar and slices containing the organelles were ¿xed again in 3% glutaraldehyde in buffer A. After washing in buffer A, the pellets were post-¿xed in 1% OsO4 in buffer A. Finally, the samples were dehydrated in a series of acetone and propylene oxide and were embedded in Durcupan resin, sectioned, and post-stained with 2% uranyl acetate and 2% Pb-citrate. Sections were cut on an Ultracut E (Reichert-Jung) ultramicrotome and examined under a Zeiss EM 900 electron microscope. Estimates for the size of the organelles in each band were obtained by randomly evaluating the ¿elds (25–30 for ¿rst and second bands, eight for third band), at a magni¿cation of 50,000×, with a total of about seven hundred organelles assessed, for each control or pancreatitic sample. Results are expressed both in control and pancreatitic groups in terms of percent relative abundance within the populations of vesicle sizes analyzed. 2.6. Separation of pancreatic NAG isoenzyme by DEAE-cellulose ion-exchange chromatography Percoll-separated lightest (primary) lysosome or soluble fraction samples were dialysed at 4 ¿C against elution buffer (10 mM sodium phosphate buffer, pH 7.0: buffer B). Dialyzed samples were loaded on to the top of a 2 ml disposable syringe packed with 2 ml of DEAE-cellulose and the elution buffer was applied to obtain the unadsorbed proteins. Bound proteins were then eluted in a linear gradient (0–0.3 M sodium chloride) in 20 ml of elution buffer. Fractions of 0.4 ml were collected, and NAG activity was determined as indicated above. Protein contents were monitored by measuring absorbance at 280 nm. The activity present in each peak was expressed as a percentage of the activity recovered in the total peaks. 2.7. Detergent analysis L + M samples were solubilised with 0.5% of the non-ionic detergent IGEPAL CA-630 for 30 min, dialyzed against buffer B, and ¿nally applied to DEAE-cellulose as indicated above. The percentages of the NAG forms were compared to those from samples not treated with the detergent. 2.8. Thermal stability Diluted primary lysosome samples were incubated at 45 ¿C. Samples were removed at different times and assayed for NAG activity under standard conditions. 2.9. Statistical analyses Data are expressed as means ± S.D. They were analyzed using the Mann–Whitney U non-parametric test. Statistical signi¿cance was considered for a P-value <0.05. The con¿dence interval was 95%. Analyses were implemented using the SPSS program for MS Windows (version 18.0). 3. Results One of the animal models of human edematous pancreatitis is that induced in the rat by Cer. Here, the establishment of AP was monitored by light microscopy and serum amylase determination: (1) histological sections of the pancreata showed normal acini and no in¿ltration in the control animals, but tissue disorganization and numerous leukocytes adhering to the vascular endothelium and also outside the vessels surrounding the acini were observed in the pancreatitic animals; (2) serum amylase activity increased signi¿cantly in AP (1220 ± 70 U/l vs 12,450 ± 3850 U/l, P < 0.006, in control and pancreatitic rats, respectively). All these features are consistent with those described previously [18,19,24–26]. 3.1. Marker enzyme activities in the subcellular fractions from pancreas Distribution of the marker enzymes in the different subcellular fractions: With respect to the homogenates, the L + M fraction was enriched: (i) 1.3-fold (P < 0.05) and 1.7-fold (P < 0.01), and 1.8-fold (P < 0.001) and 1.5-fold (P < 0.05), in NAG and cathepsin B activities (marker enzymes for lysosomes), (ii) 2- fold (P < 0.001) and 3.1-fold (P < 0.001) in SDH activity (a marker enzyme for mitochondria) in control and pancreatitic samples, respectively. By contrast, the degree of enrichment of the Mic and S fractions in the three marker enzymes was lower than in the homogenates. These data support the notion that the L + M fraction was enriched in lysosomes and mitochondria. Additionally, NAG speci¿c activity increased signi¿cantly in both the Zymogen and L + M fractions from pancreatitic rats when compared with the control group (P < 0.05). At least for the L + M fraction, this is probably due to the decrease in the amount of proteins from this fraction. The 50% of both the total NAG and cathepsin B activity was located in the L + M fraction from control pancreas. This value decreased to 38% and 22% in the case of the pancreatitic samples (P < 0.01), and this was accompanied by a concomitant increase in the marker enzyme activities of the S fraction (P < 0.01). Regarding total SDH activity, almost 60% was located in the L + M fraction in both control and pancreatitic pancreas. Moreover, AP was associated with a decrease in the amount of total proteins from the L + M fraction (P < 0.01) that was closely paralleled by an increase in the S fraction (P < 0.01). The recovery of all the above-mentioned marker enzymes, calcu- lated with respect to the homogenates, was close to 100%. Accordingly, leakage of the lysosomal enzymes was clearly accelerated in the pancreatitic group as compared with the control group. 3.2. Isolation of lysosomes from rat pancreas The L + M fraction was subjected to a discontinuous Percoll gradient. In both control and pancreatitic pancreas NAG activity was distributed in three peaks along the gradient, such peaks coinciding with three bands of organelles. Accordingly, these three bands included the lysosome populations. SDH activity was only distributed in the two peaks corresponding to the densest bands of organelles, although such activity was low. Often, the highest SDH activity was obtained at the bottom of the tube. Considering the sum of total proteins present in the lysosome subpopulations as 100%, band 1 represented more than 80% (86.5 ± 5.0% and 80.8 ± 7.0% in the control and pancreatitic pancreata, respectively). A tendency, although not signi¿cant, towards an increase in the amount of proteins included in band 2, probably at the expense of band 1, was observed in pancreatic pancreata (12.1 ± 5.9% vs 17.8 ± 6.5% in control and pancreatitic pancreata, respectively). Finally, band 3 represented only 2% of total proteins (2.1 ± 1.2% and 2.0 ± 0.4% in control and pancreatitic pancreata, respectively). 3.3. Electron microscopy studies of lysosome subpopulations In order to collect structural information about the bands obtained in the Percoll gradient, electron microscopy observations were performed. Each band was seen to have an essentially different morphology, indicating a good separation from the other bands. The ¿rst band contained the less dense (1.030 g/ml) organelles, which in the case of the control samples had a uniform appearance with little material. This population was devoid of mitochondria, as indicated above. Accordingly, this band must include primary lysosomes and endosomes. It was observed that the single lysosomal membrane had a characteristic electron-lucent halo on its luminal side. The sizes of the vesicles ranged between 0.05–0.2 and 0.05–0.55 µ,m for the control and pancreatitic pancreata, respectively. Accordingly, pancreatitis is associated with the presence of larger vesicles in this ¿rst band (25% of the total). The second band contained slightly denser vesicles (1.037 g/ml) with internal membrane fragments and even smaller vesicles inside. Thus, this band must include late endosomes (secondary lysosomes), although smaller vesicles were observed, with a size ranging between 0.05–0.45 and 0.05–0.70 µ,m for the control and pancreatitic samples, respectively. The third band had the densest organelles (1.043 g/ml), including multivesicular bodies which contained large numbers of internal vesicles and material inside. This band contained the largest organelles, although their dimensions varied considerably (0.1–1.6 and 0.05–0.75 µ,m for the control and pancreatitic pancreata respectively), and sometimes, in control samples, vacuoles as large as 1.6 µ,m with smaller vesicles inside were observed. It should be noted that the amount of material in this population was scant, hindering its morphological analysis. 3.4. Patterns of pancreatic NAG isoenzymes Since primary lysosomes corresponded mainly to the upper band of the Percoll gradient, the remaining experiments were carried out with this lysosome-enriched subpopulation. Two peaks of glucosaminidase activity were observed with ion-exchange chromatography. The ¿rst peak (form I) eluted with the equilibration buffer from a DEAE-cellulose column equilibrated at pH 7.0. When a KCl gradient was applied to the column, an additional major peak (form II) was detected. In control pancreas, the I and II forms represented 3.7% and 96.3% of the total enzyme activity, respectively. In pancreatitic pancreas, a 4.4-fold increase in form I (16.5% and 83.5% of the total enzyme activity for forms I and II, respectively) was observed. In the S fraction from control pancreas, the relative percentages of enzyme activity were 2.1% and 97.9% for forms I and II, respec- tively (Fig. 4C). A 5.4-fold increase was detected in the percentage of form I in pancreatitic pancreas. When a L + M sample from control pancreas was treated with the non-ionic detergent IGEPAL CA-630, dialyzed, and ¿nally subjected to DEAE-cellulose, a 3.7-fold increase in the percentage of form I (10.8% vs. 2.9% in detergent treated vs. non treated sample) was observed). 3.5. Thermal stability The two NAG forms from the primary lysosomes showed a different degree of stability when they were heated. Form II proved to be more labile than form I, since after 60 min at 45 ¿C the remaining enzyme activity was 70% and 25% for forms I and II, respectively. 4. Discussion The excess of Cer, a cholecystokinin analogue, stimulation leads to abnormally high secretion of digestive enzymes, resulting in AP. The pancreas of this model is histologically quite similar to the early phase of acute pancreatitis in humans [27]. The main goal of this study was to develop a procedure to isolate primary lysosomes from rat pancreas in order to assess the stability of lysosomal membranes in Cer-induced AP. Pancreatic lysosomal enzymes were not only present in the fraction enriched in lysosomes. They also appeared in: (i) the zymogen fraction, probably because they are normal components of granule contents, since the segregation of lysosomal and digestive enzymes seems to be incomplete in normal acinar cells [17,28,29]; (ii) the soluble fraction, since some lysosomal hydrolases, even under physiological conditions, undergo regulated secretion from pancreatic acinar cells [6,30]. These processes have mostly been attributed to a secretagogue-dependent diversion of the enzymes into zymogen granules [31] and secretory lysosomes [32,33], which could explain how lysosomal hydrolases can emerge from cells. Thus, the enzymes will appear in the soluble fraction after a differential centrifugation of a pancreatic homogenate. The increase in cathepsin B and total NAG activities in the soluble fraction from pancreatitic animals re¿ects an alteration in pancreatic lysosomal stability, and is consistent with previously reported data [3,4,13–15,34–38]. Also, supramaximal Cer stimulation has been associated with increases in cathepsin B gene expression [39]. The slight increase in NAG activity in the zymogen fraction after the induction of the pancreatitis could be due to a redistribution of the lysosomal and digestive enzymes, as reported by other authors [4,17]. Regarding the Percoll-separated lysosomal populations, in non-pancreatitic samples electron microscopy con¿rmed the homogeneity of the light fraction in which the primary lysosomes are located. The observed luminal halo would probably be due to the highly glycosylated luminal domains of lysosomal membrane proteins. Moreover, the NAG activity would be due to both the acid hydrolases already contained in the primary lysosomes and to the newly synthesized lysosomal enzymes that are introduced into the endocytic pathway through early endosomes, and even via the plasma membrane [40–42]. The secondary lysosomes were mainly located in the intermediate band. The larger cytoplasmic vacuoles observed for this population in the pancreatitic samples would probably correspond to vesicles with increased lysosomal enzyme activities, as has been proposed previously [36]. Finally, most of the organelles present in the densest lysosome population might be formed by multiple fusion and ¿ssion cycles between multivesicular bodies and lysosomes [43–45]. The presence of the smallest (<0.05) free vesicles detected especially in the second and third fractions from the pancreatitic samples might be due not only to a higher density of such vesicles, but also, at least in part, to their release from larger organelles, whose membranes would be more fragile, probably due to changes in their composition [46]. Additionally, it has been reported that during infusion with supramaximal doses of Cer, cathepsin B-containing organelles become progressively more fragile [4]. Also, a close relationship between the fragility of subcellular organelles and the pathogenesis of AP has been suggested by other authors [47]. Although the ¿rst (light) Percoll-separated lysosomal population exhibited the highest glucosaminidase activity, the other two lysosomal populations also displayed NAG activity due to condensing vacuoles, in which lysosomal enzymes are normally present. Thus, the gradient was able to resolve the primary and secondary lysosomes (bands 1 and 2). Since the integrity of endosomes and lysosomes is fundamental for a suitable separation of digestive proteins [48], the greater fragility of the organelles described here could be fatal for pancreatic tissue and would lead to the release of enzymes, with the consequent danger for acinar cells. Regarding the NAG molecular forms, since form I was less electronegative and thermosensitive than form II and was essentially located in the lysosomal membrane, the NAG I and II forms reported here could correspond to the previously described B and A forms, respectively [16]. Our data also support the notion that putative lysosomal damage occurring during pancreatitis would lead to an increase in both the total and form I NAG in the pancreatic soluble fraction. Such an increase could be indicative of the intensity of lysosomal alterations, as previously proposed [49]. Alternatively, it has also been proposed that an increase in lysosomal fragility might also occur during stimulated pancreatic secretion [13]. In conclusion, we have developed a method for the separation of different subpopulations of pancreatic lysosomes by using a combination of differential centrifugation and a discontinuous Percoll density gradient. The organelles isolated are suitable for the investgation of lysosomal proteins. Moreover, changes in the morphology and size of such organelles and an alteration of membrane integrity of primary lysosomes during AP have been demonstrated. Finally, the altered dynamics of the NAG molecular forms observed in AP provides additional information as an indicator of lysosomal mem- brane damage. References [1] Frossard JL, Steer ML, Pastor CM. Acute pancreatitis. Lancet 2008;371:143–52. [2] Saluja AK, Lerch MM, Phillips PA, et al. Why does pancreatic overstimulation cause pancreatitis? Ann Rev Physiol 2007;69:249–69. [3] Watanabe O, Baccino FM, Steer ML, et al. Supramaximal caerulein stimulation and ultrastructure of rat pancreatic acinar cell: early morphological changes during development of experimental pancreatitis. Am J Physiol 1984;246:G457–67. [4] Saluja AK, Hashimoto S, Saluja M, et al. Subcellular redistribution of lysosomal enzymes during caerulein-induced pancreatitis. Am J Physiol 1987;253:G508–16. [5] Halangk W, Lerch MM. Early events in acute pancreatitis. Clin Lab Med 2005;25:1–15. [6] van Acker GJD, Perides G, Steer ML. Colocalization hypothesis: a mechanism for the intrapancreatic activation of digestive enzymes during the early phases of acute pancreatitis. World J Gastroenterol 2006;12:1985–90. [7] Cosen-Binker LI, Gaisano HY. Recent insights into the cellular mechanisms of acute pancreatitis. Can J Gastroenterol 2007;21:19–24. [8] Dlugosz JW, Triebling AT, Brzozowski J. The role of lysosomal alterations in the damage to the pancreas and liver in acute experimental pancreatitis in dogs. Mater Med Pol 1993;25:119–25. [9] De Duve C. Lysosomes revisited. Eur J Biochem 1983;137:391–7. [10] Kornfeld S, Mellman I. The biogenesis of lysosomes. Annu Rev Cell Biol 1989;5:483–525. [11] Kunziker W, Geuze HJ. Intracellular traf¿cking of lysosomal membrane proteins. BioEssays 1996;118:379–89. [12] Ohmura M, Yamamura KI. Autophagy and acute pancreatitis: a novel autophagy theory for trypsinogen activation. Autophagy 2008;4:1060–2. [13] Wilson JS, Korsten MA, Apte MV, et al. Both ethanol consumption and protein de¿ciency increase the fragility of pancreatic lysosomes. J Lab Clin Med 1990;115:749–55. [14] Baniukiewicz AA, Dlugosz JW, Gabryelewicz A. The lysosomal hydrolases in the rat pancreas after maximal or supramaximal stimulation with cerulein. Int J Pancreatol 1994;16:71–9. [15] Guillaumes S, Blanco I, Villanueva A, et al. Activity and subcellular distribution of lysosomal enzymes in acute pancreatitis induced by CDE diet in mice. Gastroenterol Hepatol 1996;19:146–52. [16] Robinson D, Stirling J. N-acetyl-ß-glucosaminidases in human spleen. Biochem J 1968;107:321–7. [17] Willemer S, Bialek R, Adler G. Localization of lysosomal and digestive enzymes in cytoplasmic vacuoles in caerulein-pancreatitis. Histochemistry 1990;94:161–70. [18] Sarmiento N, Sánchez-Bernal MC, Ayra M, et al. Changes in the expression and dynamics of SHP-1 and SHP-2 during caerulein-induced acute pancreatitis in rats. Biochim Biophys Acta 2008;1782:271–9. [19] Sarmiento N, Sánchez-Bernal MC, Pérez-González MN, et al. Rolipram and SP600125 suppress the early increase in PTP1B expression during cerulein-induced pancreatitis in rats. Pancreas 2009;39:639–45. [20] Sánchez-Bernal C, García-Morales OH, Domínguez C, et al. Nitric oxide protects against pancreatic subcellular damage in acute pancreatitis. Pancreas 2004;28:e9–15. [21] Mc Donald JK, Ellis S. On the substrate speci¿city of cathepsin B1 and B2 including a new ¿uorogenic for cathepsin B1 . Life Sci 1975;17:1269–76. [22] Pennington RJ. Biochemistry of distrophic muscle, mitochondrial succinatetrazolium reductase adenosine triphosphatase. Biochem J 1961;80:649–54. [23] Marxwell MAK, Haas SM, Bieber LL, et al. A modi¿cation of the Lowry procedure to simplify protein determination in the membrane and lipoprotein samples. Anal Biochem 1978;87:206–10. [24] Alonso R, Montero A, Arévalo M, et al. Platelet-activating factor mediates pancreatic function derangement in caerulein-induced pancreatitis in rats. Clin Sci 1994;87:85–90. [25] Yönetc¸ i N, Oruc¸ N, Ozütemiz AO, et al. Effects of mast-cell stabilization in caerulein-induced acute pancreatitis in rats. Int J Pancreatol 2001;29:163–71. [26] Zhao M, Xue DB, Zheng B, et al. Induction of apoptosis by artemisin relieving the severity of in¿ammation in caerulein-induced acute pancreatitis. World J Gastroenterol 2007;14:5612–7. [27] Cheung YC, Leung PS. Acute pancreatitis: animal models and recent advances in basic research. Pancreas 2007;34:1–14. [28] Hirano T, Saluja A, Ramarao P, et al. Effects of chloroquine and methylamine on lysosomal enzyme secretion by rat pancreas. Am J Physiol 1992;262:G344–439. [29] Hirano T. Lysosomal enzyme secretion into pancreatic juice in rats injected with pancreatic secretagogues and augmented secretion after short-term pancreatic duct obstruction. Nippon Geka Hokan 1994;63:21–35. [30] Rinderknecht H, Renner IG, Koyama HH. Lysosomal enzymes in pure pancreatic juice from normal healthy volunteers and chronic alcoholic. Dig Dis Sci 1979;24:180–6. [31] Hirano T, Manabe T, Saluja AK, et al. Pancreatic secretion of lysosomal enzymes stimulated by intraduodenal instillation of a liquid meal in rabbits. Clin Sci (Lond) 1992;83:277–80. [32] Grondin G, Beaudoin AR. Immunocytochemical and cytochemical demonstration of a novel selective lysosomal pathway (SLP) of secretion in the exocrine pancreas. J Histochem Cytochem 1996;44:357–68. [33] Andrews NW. Regulated secretion of conventional lysosomes. Trends Cell Biol 2000;10:316–21. [34] Lampel M, Kerrn HF. Acute interstitial pancreatitis in the rat induced by excessive doses of a pancreatic secretagogue. Virchows Arch A Pathol Anat Histol 1977;373:97–117. [35] Adler G, Rohr G, Kern HF. Alteration of membrane fusion as a cause of acute pancreatitis in the rat. Dig Dis Sci 1982;27:993–1002. [36] Adler G, Hahn C, Kern HF, et al. Cerulein-induced pancreatitis in rats: increased lysosomal enzyme activity and autophagocytosis. Digestion 1985;32:10–8. [37] Saluja AK, Saito I, Saluja M, et al. In vivo rat pancreatic acinar cell function during supramaximal stimulation with caerulein. Am J Physiol 1985;249:G702–10. [38] Saito I, Hashimoto S, Saluja A, et al. Intracellular transport of pancre- atic zymogens during caerulein supramaximal stimulation. Am J Physiol 1987;253:G517–26. [39] Yuan S, Rosenberg L, Ilieva A, et al. Early changes of gene expression during cerulein supramaximal stimulation. Pancreas 1999;19:45–50. [40] Peters C, Braun M, Weber B, et al. Targeting of a lysosomal membrane protein: a tyrosine-containing endocytosis signal in the cytoplasmic tail of lysosomal acid phosphatase is necessary and suf¿cient for targeting to lysosomes. EMBO J 1990;9:3497–506. [41] Ludwig T, Grif¿ths G, Ho¿ack B. Distribution of newly synthesized lysosomal enzymes in the endocytic pathway of normal rat kidney cells. J Cell Biol 1991;115:1561–72. [42] Tjelle TE, Brech A, Juvet LK, et al. Isolation and characterization of early endosomes, late endosomes and terminal lysosomes: their role in protein degradation. J Cell Sci 1996;109:2905–14. [43] Futter CE, Pearse A, Hewlett LJ, et al. Multivesicular endosomes containing internalized EGF-EGF receptor complexes mature and then fuse directly with lysosomes. J Cell Biol 1996;132:1011–23. [44] Luzio JP, Pryor PR, Bright NA. Lysosomes: fusion and function. Nat Rev Mol Cell Biol 2007;8:622–32. [45] van Meel E, Klumperman J. Imaging and imagination: understanding the endo- lysosomal system. Histochem Cell Biol 2008;129:253–66. [46] Ferreira-Redondo L, Pérez-González N, Llanillo M, et al. Acute pancreatitis decreases pancreas phospholipid levels and increases susceptibility to lipid peroxidation in rat pancreas. Lipids 2002;37:167–71. [47] Hirano T, Manabe T, Yotsumoto F, et al. Effect of prostaglandin E on the redistribution of lysosomal enzymes in caerulein-induced pancreatitis. Hepatogastroenterology 1993;40:155–8. [48] Scheele GA. Biosynthesis, segregation, and secretion of exportable proteins by the exocrine pancreas. Am J Physiol 1980;238:G467–77. [49] Brzozowski J, Dlugosz J, Gabryelewicz A. Pancreatic lysosomal hydrolases in acute experimental pancreatitis in dogs. Z Exp Chir Transplant Kunstliche Organe 1984;17:350–9. Increase and missorting of LAMP-2 during cerulein-induced pancreatitis in rats Nancy Sarmientoa, Carmen Sánchez-Bernala, Violeta García-Hernándeza, Arturo Mangasb,Angel Hernández-Hernández a, José J. Calvoc, Jesús Sánchez-Yagüea,* aDepartment of Biochemistry and Molecular Biology, University of Salamanca, Spain bDepartment of Cell Biology and Pathology, University of Salamanca, Salamanca, Spain, cDepartment of Physiology and Pharmacology, University of Salamanca, Spain *Corresponding author. Departamento de Bioquímica y Biología Molecular, Edificio Departamental. Lab. 106, Plaza Doctores de la Reina s/n, 37007 Salamanca, Spain. Fax: +34 923 294579 E-mail address: sanyaj@usal.es (J. Sánchez-Yagüe) Abstract Lysosomal LAMP-2 plays an important role in the cytoplasmic vacuolization of acinar cells in pancreatitis. We report increases in pancreatic LAMP-2 protein and mRNA levels as early events during the development of cerulein (Cer)-induced acute pancreatitis (AP), which returned to below baseline levels in its later phase. The increase in protein levels was due to a soluble-type form with a higher molecular weight (˜120 kDa) than LAMP-2 in control pancreata. Nevertheless, in a lysosome-enriched fraction LAMP-2 expression decreased along the development of Cer-induced AP, as well as in three density-separated lysosomal subpopulations. Immunostaining revealed that the cellular source of LAMP-2 following Cer administration was mainly acinar and islet cells. Neutrophil infiltration was not the main cause of the increased LAMP-2 protein levels, as observed when rats were rendered neutropenic with vinblastine sulfate. The endoglycosidase-H resistance of the 120 kDa LAMP-2 form indicated that it was not a high-mannose precursor. Additionally, its higher molecular weight was not due to an association with a small protein but to a change in its glycosylation pattern (not related to a difference in its sialic acid level), accompanied by resistance to its complete deglycosylation with peptide N-glycosidase treatment. Together, these results indicate that the pancreatic expression of LAMP-2 increases during the early phase of Cer-induced AP, while a different post-translational processing in its carbohydrate content, accompanied by cellular missorting, would finally lead to a decrease in its expression in the lysosome. Keywords: LAMP-2; Cerulein; Acute pancreatitis 1. Introduction Pancreatitis is an auto-digestive disease that damages acinar cells and causes severe inflammation [1]. One of the animal models of human edematous pancreatitis is that induced in the rat by cerulein (Cer). The treatment used in the model of acute pancreatitis (AP) of the present studies, results in several manifestations of pancreatitis, including interstitial edema and hyperamylasemia, different indicators of morphological and histological damage to the pancreas, and neutrophil infiltration [2-6]. It is reasonable to assume that the development of pancreatitis would be based on rapid early events. It is known that early on in the course of secretagogue- induced pancreatitis, lysosomal hydrolases colocalize with digestive zymogens and activate them [7,8], which is believed to be essential in the development of pancreatitis [9]. Furthermore, an inhibition of the release of secretory proteins as well as an alteration of protein trafficking occurs in Cer-induced pancreatitis [10]. In fact, in AP this altered vesicular traffic in the secretory pathway is involved in vacuole formation and the activation of intracellular zymogens [11]. It is also known that in AP glycoprotein processing is inhibited in the Golgi complex [10]. Membrane glycoproteins in the secretory pathway are believed to exert protective effects, especially for compartments with active enzymes such as the lysosome. Thus, changes in the processing of glycoproteins in pancreatitis may significantly alter lysosome membrane stability, which could finally affect vacuole disruption and the release of active proteases into the cytosol [10]. LAMP-2 (lysosomal-associated membrane protein 2), also called lgp96 in the rat, is an ubiquitous major type-I transmembrane protein of the lysosome that is extensively glycosylated in its large luminal/extracellular domain. It is highly expressed in normal pancreatic tissue [12]. The molecular mass of the polypeptide backbone is around 40 kDa, but after glycosylation its mass increases up to almost 100-120 kDa [13], depending on the cell type and organism. Several mRNAs arising from alternative splicing of a single transcript encode three LAMP-2 molecules that differ in their single transmembrane and short cytoplasmic tail [14]. LAMP-2, as well as other LAMPs, can follow two different pathways to reach the lysosome [15]: (1) from the trans-Golgi to late endosomes or to lysosomes, (2) another different and complex pathway, involving movement to early endosomes and the cell surface, before delivery to lysosomes after several rounds of exocytosis and endocytosis. However, the distribution and sorting events responsible for the transfer of lysosomal membrane glycoproteins to their final destination may differ among cells [16]. Thus, the enrichment of different proteins in the lysosome is a dynamic condition resulting from complex trafficking among several cellular compartments. Although the levels of LAMPs at the cell surface are usually low at steady-state, the regulated movement of LAMPs between the plasma membrane and the endocytic pathway may play important roles in the maintenance of cell-cell interactions due to their complex saccharide chains [14]. In this sense, the changes in LAMP distribution are often accompanied by alterations in the glycosylation pattern of LAMPs. It has been proposed that lysosomal LAMP-2 would have several functions: (1) a specific function in chaperone-mediated autophagy, (2) a role as a receptor on the lysosomal membrane, designed to mediate the binding and transport of substrate cytosolic proteins into lysosomes for degradation [17], (3) it is required for the proper fusion of lysosomes with autophagosomes in the late stage of the autophagic process [18]. Autophagy is a cytoprotective mechanism through which cells maintain homeostatic functions such as protein and organelle turnover. LAMP-2 depletion results in the inhibition of cytoprotective autophagy signaling secondary to the failure of fusion between lysosomes and autophagosomes [19]. In humans, Danon disease is a consequence of mutations in the gene encoding LAMP-2. This pathology is characterized by the accumulation of late autophagic vacuoles in the heart and skeletal muscle [20]. Additionally, mice deficient in Lamp-2 exhibit an accumulation of autophagic vacuoles in several tissues, including pancreatic acinar cells [21]. Cytoplasmic vacuolization is also one of the early signs of cellular and tissue damage in pancreatitis, although its precise mechanism is not fully understood. Recently, based on an alcoholic model of pancreatitis it has been proposed that pancreatitic acinar cell vacuolization is mediated by an inhibition of the late stage of autophagy, in which the depletion of lysosomal proteins, including LAMP-2, would play a critical role [22]. Nevertheless, the reasons for such depletion and the dynamics of LAMP-2 during the course of pancreatitis has not been addressed previously. Bearing in mind the importance of unmasking the molecules or genes whose expression changes along the development of AP, the goal of the present work was to study the expression and cell dynamics of LAMP-2 as from the early phase of Cer-induced AP. 2. Materials and methods 2.1. Reagents Agarose-conjugated lectin from Triticum vulgaris (wheat germ agglutinin, WGA), cerulein, concanavalin A-sepharose 4B (Con A) from Canavalia ensiformis, monoclonal antibody anti-ß-Tubulin, Protease Inhibitor Cocktail, sodium taurocholate, Trizol Reagent, trypsin inhibitor, and vinblastine sulfate were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Density marker beads were purchased from Pharmacia (Uppsala, Sweden). The Oxyblot protein oxidation detection kit was obtained from Intergen (Purchase, NY, USA). The 2-D Clean-Up Kit was obtained from GE Healthcare (GE Healthcare Europe, Barcelona, Spain). Anti-LAMP-2 polyclonal antibody was obtained from Zymed Laboratories Inc (Invitrogen, Carlsband, CA, USA). Biotinylated anti-rabbit immunogammaglobulin and avidin–biotin–peroxidase complex were purchased from Vector (Burlingame, CA, USA). 2.2. Animals Male Wistar rats weighing 250-280 g were used. Care was provided in accordance with the procedures outlined in European Community guidelines on ethical animal research (86/609/EEC), and the protocols were approved by the Animal Care Committee of the University of Salamanca. 2.3. Induction of AP and preparation of samples AP was induced as described previously [6,23,24]. Briefly, rats received up to 4 s.c. injections of 20 µg Cer/kg body weight or its vehicle (0.9% NaCl) at hourly intervals. At 2, 4 or 9 h after the first injection, the animals were killed by cervical dislocation. The pancreata were rapidly harvested and used immediately for experiments. In some cases, AP was also induced by sodium-taurocholate duct infusion or bile-pancreatic duct obstruction (BPDO), as indicated previously [23]. After dissection and homogenization of the pancreata [23], postnuclear homogenates were obtained [23]. Subcellular fractionation was carried out in the homogenates following a method in which lysosomes were coprecipitated with mitochondria at 20,000 ¿¿g after separation of the zymogen fraction at 1300 ¿¿g, as described previously by us [23,24]. Four subcellular fractions were obtained: the zymogen (Z), the lysosome plus mitochondria (L+M), the microsome (Mic) and the soluble (S) fractions. Serum amylase was measured as reported previously [6,23]. Protein concentrations were assayed according to the method of Bradford [25]. 2.4. Induction of neutropenia Neutropenia was induced in rats by intravenous (i.v.) injection of vinblastine sulfate at a dose of 0.75 mg/kg on day 1, as previously described [6,23]. At this dose, the animals become neutropenic between days 4 and 6 [26]. On day 5 following vinblastine sulfate or saline administration, the animals were treated with 4 doses of Cer (20 µg Cer/kg, administered at hourly intervals), and killed 4 h after the first injection of Cer (intermediate phase of AP). 2.5. Percoll gradient centrifugation Aliquots (0.5 ml) of the L+M fractions diluted three times in 3 mM imidazole buffer, pH 7.4 containing 0.25 M sucrose, 1 mM EDTA, 1mM PMSF, 100 µg/ml trypsin inhibitor and 2 µl/ml Protease Inhibitor Cocktail (buffer A [6]) were layered on top of discontinuous gradients (performed in ultraclear centrifuge tubes) consisting of three layers of isotonic 17%, 10% and 5% Percoll solutions (3.8 ml each) prepared in buffer A and placed from the bottom of the tube upwards, respectively. The density partial-gradients were then formed by centrifugation at 50,500 ¿g for 30 min in a Beckman SW40 rotor. For the calibration of the Percoll density gradients, density marker beads were used, following the manufacturer’s instructions. Three bands of organelles were recovered close to the interfaces of the density gradients. Each band was collected with a Pasteur pipette, diluted with buffer A, and washed by centrifugation at 50,000 x g for 15 min to remove the Percoll reagent. The organelles, which were located above the Percoll pellet, were finally transferred to Eppendorf tubes for their use in sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting. The morphologic characterization of these bands has been described elsewhere (Sarmiento at al., 2009. Manuscript submitted for publication). 2.6. RNA preparation and RT-PCR Total RNA was isolated from the pancreas and brain of the same rat by immediate solubilization in Trizol Reagent and isopropanol purification. RT-PCR was performed as previously described [6,23]. The oligonucleotide sequences were as follows: LAMP2: forward oligo: 5´-CCACCGCTATGGGCACAAGGAAGTT-3´ reverse oligo: 5´-CAGCTGAACATCACCGAGGAGAAGG-3´ Product length was 427 pb. Oligonucleotide primers for ß-actin were used as an internal control (forward oligo: 5´-TCTGTGTGGATTGGTGGCTCTA-3´; reverse oligo: ´5´-CTGCTTGCTGATCCACATCTG-3´). 2.7. Light microscopy and immunohistochemistry Paraffin-embedded tissue sections (8-to 10-µm thick) were stained with hematoxylin and eosin (H&E staining), as indicated previously [6], or subjected to immunostaining using the streptavidin peroxidase technique. For the latter, the sections were incubated for 30 min at room temperature in phosphate-buffered saline (0.15 M, pH 7.2) containing 1% normal horse serum and 0.3% Triton X-100 (buffer A) before overnight incubation at 4 ºC with anti-LAMP2 polyclonal antibody diluted 1:50. Bound antibody was detected with a biotinylated anti-rabbit immunoglobulin (Ig) G (1 h, 1:200 dilution in buffer A at room temperature) and an avidin–biotin–peroxidase complex (1 h, 1:100 dilution in buffer A at room temperature). The tissue- bound peroxidase was developed with H2O2, using 3,3-diaminobenzidine as chromogen. To ensure the specificity of the primary antibody, we incubated sections in either the absence of the primary antibody or with a non-immunized rabbit IgG antibody. In these cases, no immunostaining was detected. For estimation of the intensity of immunostaining, random film images were scanned, using the Adobe Photoshop program (version CS2), and the images were then analysed with the MacBas v 2.5. program. At least 8-10 fields were evaluated at a magnification of ¿¿4 in both the control and Cer-treated groups. In each image, small rectangles (50-60) of equal surface area were analyzed, which altogether basically represented all the acini observed in each image. The results are expressed as arbitrary units (AU) per equivalent area (500 px2). 2.8. SDS-PAGE and Western blotting In experiments addressing LAMP-2 expression, proteins were analysed by dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) using 8% or 10% gels, after which they were transferred to polyvinylidene difluoride membranes. Western blots were probed with anti- LAMP2 polyclonal or the approximate loading-control: anti-ß-Tubulin monoclonal antibodies diluted 1:1000 and 1:4000, respectively. Blots were visualized by chemiluminescence. Analyses of the spots on all the blots were performed as described previously [6,23]. Some samples were pretreated with 2-D Clean-Up kit to precipitate proteins, leaving behind non-protein impurities and allowing the rehydratation buffer to be changed. For this, the manufacturer´s instructions were followed. Protein carbonyl contents and profiles were measured by immunoblot detection using the Oxyblot protein oxidation detection kit, as indicated elsewhere [27,28]. Briefly, 15 mg of protein from each sample was incubated with DNPH for 15 min at room temperature. Samples were neutralized, reduced by the addition of 2-mercaptoethanol, and loaded into 6% SDS-PAGE gels. After electroblotting , oxidized proteins were revealed with an anti-DNP antibody, and visualized by chemiluminescence. In studies addressing the carbohydrate content of LAMP-2, samples were first incubated with no additions for different times; with 100 mU/ml neuraminidase for up to 24 h; with 10 U/ml peptide N-glycosidase-F (PGNase-F) for 8 or 24 h, or with 100 mU/ml endoglycosidase-H (Endo-H) for 24 h in the presence of 2 µl/ml Protease Inhibitor Cocktail, at 37 ºC and under gentle shaking. Neuraminidase treatment: samples were first dialyzed against 50 mM sodium acetate buffer, pH 5.5 or 6, containing 134 mM NaCl and 9 mM CaCl2, after which 2.5% NP-40 (final concentration) was added before neuraminidase incubation. Aliquots were collected at different times and used for blotting. PGNase-F treatment: 1% NP-40 (final concentration) was added and the samples were kept on ice for 1 h with occasional shaking. Then, 0.1% SDS and 10mM ß-mercaptoethanol (final concentration, dissolved in 3 mM imidazole buffer, pH 7.4 [25]) were added, and samples were boiled for 10 min After 5 min on ice, PGNase-F was added and the samples were incubated at 37 ºC. Endo-H treatment: as for PGNase-F treatment, but the pH of samples was first adjusted to 5.5-6, and SDS and ß-mercaptoethanol were dissolved in 3 mM imidazole buffer, pH 5.5. 2.9. Treatment of solubilized LAMP-2 with lectins Pancreatic samples were first solubilized at 4 ºC with 0.5-1% NP-40 for 60 min under continuous rotation. Fixed amounts of solubilized proteins were mixed in Eppendorf tubes with 200 µl of immobilized lectins resuspended in 3 mM imidazole buffer, pH 7.4 containing 0.5% NP-40. The mixtures were rotated for 4 h at 4 ºC and then centrifuged in a table centrifuge at full speed for 10 min These conditions were chosen for convenience and did not represent the optimal ones for maximal lectin binding. The supernatants represented the lectin-unbound proteins (supernatant 1, Sp 1) Then, the gels were washed twice with imidazole buffer, centrifuged again, and finally the lectin-bound proteins were eluted from the lectins with 0.5 M N-acetyl-glucosamine (WGA) or 1M methyl a-mannopyranoside (Con A) overnight at 4 ºC under rotation. Centrifugation of the mixtures afforded the lectin-bound proteins (supernatant 2, Sp 2). 2.10. Statistical analyses Data are expressed as means ± S.D. They were analysed using the non-parametric Mann- Whitney U test. Statistical significance was considered for a p value <0.05. Analyses were implemented using the SPSS program for MS Windows (version 15.0). 3. Results 3.1. Changes in the expression of LAMP-2 during the development of AP As we have reported previously [6,23], the expression of data with respect to the whole pancreas would be more appropriate because pancreatitis is associated with cell death and neutrophil infiltration. These features imply that the pancreata of control and pancreatitic rats will have different cell compositions. Accordingly, the exact amount of any protein, including LAMP-2, should be calculated in the whole organ rather than in a fixed amount of proteins. Here, we observed an increase in the expression of LAMP-2 in the early phase of AP (2 h after the first injection of Cer) (3.4±0.7-fold that of controls), which persisted in the intermediate phase ( 4.5 1.6-fold that of controls). In the later phase, once Cer-induced AP had fully developed, LAMP-2 expression fell to levels even lower than those of the controls (0.8 0.1-fold that of the controls). Nevertheless, LAMP-2 from pancreatitic pancreata showed a higher molecular weight (˜120 kDa) than the well established molecular weight of LAMP-2 in control pancreata (˜96 kDa). The establishment of AP was tested by checking that serum amylase activity did indeed increase significantly along the development of pancreatitis. Also, using histological sections of pancreata, we have previously demonstrated [6] that our model of pancreatitis shows tissue architecture and leukocyte infiltration consistent with parameters described previously for AP [1,3,4]. Moreover, in the early phase of AP (2 h), LAMP-2 mRNA levels were increased in pancreata but hardly not at all in a control organ with Cer receptors (brain), in which the expression of LAMP-2 protein remained constant. Since it has been described that oxidative stress transcriptionally regulates at least LAMP-2A expression [29], we wondered if we could detect such stress in the early phase of AP by analyzing the carbonyl content of the proteins from different subcelular fractions as well as the pancreatic homogenate. We observed different proteins clearly became carbonylated, or their levels of carbonylation were increased. Previous results did not reveal individual, selectively modified proteins in Cer-induced AP [30]. This difference seems to be due to the fact that most of the newly modified proteins were mainly visible with 6% rather than with 10% gels. To examine the cellular source of LAMP-2 following Cer administration, we performed immunohistochemical studies. In the control pancreata, a moderate to strong degree of immunoreactivity was present in islet cells, and a faint immunostaining was observed in acinar cells. The ductal cells of the normal pancreata were mostly negative for LAMP-2, as reported previously for normal human pancreas [31], although some of them were very slightly immunostained. Blood vessel endothelial cells were completely negative for LAMP-2. During the early and intermediate phase of Cer-induced AP, an increase in the immunoreactivity of both acinar and islet cells was detected. In fact, the image analysis used here revealed significant increases (˜ 45% and 28%, 2 h and 4 h after the first Cer injection, respectively) in the mean intensity of acinar cell immunostaining: 799 ± 519, 1157 ± 522 and 1029 ± 558 AU/500 (px2), p = 0.001, for control, 2 h and 4 h Cer-treated rats, respectively, similar to the values observed for islet cells. Also, in comparison with the control pancreata an increase in the number of ductal cells showing a weak immunostaining was found, although again most of these cells were negative for LAMP-2. 3.2. LAMP-2 subcellular distribution during the development of AP The results corresponding to the early phase of Cer-induced AP (2 h after the first injection of Cer). In total control pancreata, LAMP-2 was located in the four subcellular fractions analyzed, although almost 50% was present in the L+M fraction. In the Cer-injected animals, almost 94% of LAMP-2 was associated with the soluble fraction and, as expected, it corresponded to the 120 kDa form. Notably, this LAMP-2 form was also detected in the microsome fraction in significant amounts. The amount of LAMP-2 in the L+M fraction decreased significantly along the development of Cer-induced AP (60-90% of the LAMP-2 expressed in total control pancreata). Additionally, in the intermediate and later phases of Cer-induced AP (4 and 9 h after the first injection of Cer, respectively), the 120 kDa LAMP-2 form was also detected in the L+M subcellular fraction, although it was not always detectable. Finally, the decrease in LAMP-2 expression after Cer-induced AP was also observed in three density-separated lysosomal subpopulations obtained after Percoll-centrifugation of the L+M fraction. These subpopulations were mostly devoid of succinate dehidrogenase activity, a marker of mitochondria, which were mainly located at the bottom of the tube. The 120 kDa LAMP-2 form was also detected in another two models of AP: the BPDO and taurocholate models, although it was mainly expressed in the BPDO model, also as a soluble-type form. The presence of LAMP-2 in the soluble fraction is intriguing because LAMP-2 is an integral protein. To analyze this feature, we then submitted the soluble fraction of both control and pancreatitic pancreata to centrifugation at 400,000 ¿¿g. Most of the 96 kDa LAMP-2 form present in control pancreata was in fact a membrane-associated protein, because after centrifugation it was mainly located in the precipitate (70-80%). By contrast, the 120 kDa LAMP-2 form was mainly located in the supernatant (˜ 98%). This result suggests that the 120 kDa LAMP-2 form is soluble or, if membrane-associated, that the amount of lipids surrounding the enzyme would be insufficient to allow the enzyme to reach the precipitate. 3.3. Influence of neutrophil infiltration In pancreatitis, neutrophil infiltration is an important component in the development of both inflammation and cell death. It has been reported that during the intermediate phase of AP inflammatory cell infiltration has already started or taken place [32], as we observed in our AP model by light microscopy analysis [6]. Therefore, we decided to perform the study 4 h after the first injection of Cer. As expected, neutropenia was associated with the disappearance of neutrophils from the blood: 40 ± 6% and 0% neutrophils in a differential leukocyte count in the blood from Cer-induced AP (4 hours) rats not-pretreated or pretreated with vinblastine sulfate, respectively, n = 3. Moreover, vinblastine treatment resulted in blunted pancreatic MPO levels, pointing to an in situ depletion of neutrophil infiltration, as described elsewere [23]. We have previously reported that under the same conditions described here vinblastine treatment alone did not affect serum amylase activity and that vinblastine treatment in Cer-treated rats did not decrease serum amylase levels [6,23]. Although the depletion of neutrophils in the rats slightly suppressed (˜ 20%) the increase in LAMP-2 protein expression at 4 h after Cer treatment, neutrophil infiltration did not seem to be the main cause of that increase, and neither did it prevent the expression of the 120 kDa LAMP-2 form. Furthermore, it is clear that the 120 kDa LAMP-2 form is not the LAMP-2 protein expressed in rat lymphocytes. 3.4. Studies addressing the nature and carbohydrate content of the 120 kDa LAMP-2 The higher molecular weight of the 120 kDa LAMP-2 does not seem to be due to an association with a small protein, because its size did not change even after rehydration in a buffer containing 7M urea; i.e., the buffer solution usually employed in two-dimensional electrophoresis. Accordingly, we attempted to demonstrate that the 120 kDa LAMP-2 was, as expected, a glycoprotein. We detected this protein was bound by two different lectins. Although the experiments were not designed to be quantitative, WGA seemed to bind the 120 kDa LAMP-2 more efficiently than Con A, possibly reflecting a better recognition of ß-N-acetylglucosamine by WGA than of a-linked mannose residues by Con A. Finally, we performed experiments to address the carbohydrate content of the 120 kDa LAMP-2. For this, the most appropriate conditions for the functioning of the different enzymes used were employed. The neuraminidase treatment did not significantly change the molecular size of either the 96 kDa or the 120kDa LAMP-2 located in the soluble fraction of the control and pancreatitic pancreata. This result suggests the absence, or very low levels, of terminal sialic acids, whose elimination would not change the electrophoretic mobility of LAMP-2. The complete deglycosylation of the LAMP-2 located in the L+M fraction from control pancreata after treatment with PGNase F resulted in a decrease in the molecular size of the protein down to 40-45 kDa, which is the molecular weight of its backbone. Despite this, PGNase treatment of the soluble fraction from pancreatitic pancreata did not afford the same result. In fact, the molecular weight of the120 kDa LAMP-2 was only very slightly reduced, and did not even reach the regular 96 kDa of LAMP-2. Finally, treatment with Endo-H, an endoglycosidase that breaks down high-mannose-content carbohydrates, did not change the molecular weight of the 120 kDa LAMP-2. This Endo-H resistance indicated that it was not a high-mannose precursor of LAMP-2. Taken together, these results indicate that the higher molecular weight of LAMP-2 seen in pancreatitic pancreata is probably due to a change in its glycosylation pattern, accompanied by resistance to its complete deglycosylation with PGNase treatment. 4. Discussion It has been proposed that alterations in gene and/or protein expression within the initiation phase of AP play an important role in its development [33]. It has also been suggested that the final step of autophagy signalling is inhibited, presumably due to the depletion of lysosomal proteins, which is associated with the acinar cell vacuolization observed in pancreatitis [22]. Based on these features, here we show that the pancreatic expression of LAMP-2, an integral protein of lysosomes directly involved in autophagy, is increased at the level of both protein and mRNA as from the early phase of Cer-induced AP. Nevertheless, it seems to have a different post-translational processing in its carbohydrate content, which is accompanied by cellular missorting, and hence it behaves as a soluble-type protein. As a consequence, its level of expression decreases dramatically in the lysosome. Previous studies of both the Cer-induced and the taurocholate models of pancreatitis have revealed increased oxidative stress, and oxidative protein modification as an early event [30, 34]. Here we show that in fact oxidative stress, detected as the appearance or an increase in the level of oxidized proteins in different subcelular fractions or whole pancreas homogenates, occurs during the early phase of Cer-induced AP. This oxidative stress might be the cause of the increased LAMP-2 mRNA level detected here. In fact, in rat liver it has been described that oxidative stress increases chaperone-mediated autophagy (CMA), the mechanism responsible for the selective degradation of cytosolic proteins in lysosomes during stress conditions. In this case, one of the LAMP-2 members, LAMP-2A, is overexpressed due to transcriptional regulation, its mRNA level being increased [29]. LAMP-2 has been found to occur as spliced-variant molecules (LAMP-2A, -2B and -2C), which are encoded by different transcripts in chicken, mouse and human cells [19]. The differences in the amino acid sequences of the three variants are confined to the transmembrane region and cytosolic tail [17]. In the mouse, it has been reported that the LAMP-2A transcript is the most prevalent one in the pancreas during morphogenesis [35]. The primers used in our RT-PCR analysis allowed us to follow all the LAMP-2 mRNA types. Thus, the issue that it is indeed the LAMP-2 variant that affords the increase in LAMP-2 gene expression detected in Cer-induced AP remains to be resolved, although the data concerning the stress-mediated transcriptional regulation of LAMP-2A in rat liver, as indicated above, suggest that it would be the LAMP-2 form that is involved. Additionally, there is a tissue-dependent expression of the different forms of LAMP-2 [12], suggesting that they might have different cellular functions. It has previously been reported that in the normal human pancreas LAMP-2 mRNA is present in islet and acinar cells, but absent in ductal cells, and that LAMP-2 protein immunoreactivity is detected only in islet cells, macrophages, and acinar cells [31]. The immunostaining procedure performed here revealed that in the rat LAMP-2 was also present, mainly but not exclusively, in islet and acinar cells, and that, importantly, during its early phase, Cer-induced AP was associated with a similar increase in LAMP-2 expression in both types of cell. Nevertheless, the much greater numbers of acinar vs islet cells in whole pancreas means that most of the increase observed here would reflect the increase associated with acinar cells. The meaning of LAMP-2 overexpression in islet cells from Cer-induced AP is unknown and deserves further investigation, although it is out of the scope of this work. Also, the overexpression of LAMP-2 is a feature associated with a high proportion of pancreatic carcinomas, although in our hands, it was located mainly in ductal carcinoma cells [31]. One of the early signs of cell and tissue damage in pancreatitis is cytoplasmic vacuolization, a common feature in pathological alterations of acinar cells that, however, is not completely understood [36]. Such vacuoles are linked to an alteration of autophagy, a cytoprotective mechanism through which cells deliver autophagosomes (carrying cytosolic components and organelles) to lysosomes, thus forming autophagolysosomes or autolysosomes, which are devoted to the degradation of the autophagic cargo. In fact, autophagy is one of the cell responses to stress, [33], and endoplasmic reticulum stress occurs during AP, pancreatic acinar cells being particularly susceptible to ER perturbations [37]. It is also known that the formation of autophagolysosome is a LAMP-2-dependent process, since LAMP-2 depletion results in the failure of lysosomes and autophagosomes to fuse [19]. Accordingly, vacuolization in Cer-induced AP might be explained in terms of an accumulation of autophagosomes, as has been proposed in alcoholic pancreatitis [22]. The decreased-LAMP-2 expression in lysosomes detected in this work, as a consequence of the missorting of the protein, might be physiologically relevant because it could be directly related to such an accumulation, although at present it is not possible to distinguish between a specific role of LAMP-2 and a general exhaustion of the lysosomal system as being responsible for the inhibition of autophagy observed in AP, as has been pointed out previously [22]. In retinal pigment epithelium, a mistargeting of cathepsin D (the main lysosomal protease) into the extracellular space has been shown to occur, probably due to an accumulation of the products of lipid peroxidation (oxidatively damaged lipid-protein complexes) [38]. Lipid peroxidation processes and the covalent binding of 4-hydroxyalkenals to the sulfhydryl groups of pancreatic tissue proteins also occur in Cer-induced AP [39,40]. Notably, LAMP proteins contain different conserved cysteine residues that, under normal conditions, form the four disulfide loops present in the intralysosomal portion [41]. By contrast, apparently an increase in 4-hydroxynonenal bound to pancreatic protein histidines does not occur in the taurocholate model of pancreatitis [34], although it does occur in the lung [42]. The implications of the accumulation of oxidized lipid-protein cross-links in the missorting of lysosomal proteins in pancreatitis remain to be explored. In any case, the inhibition of secretion that occurs in pancreatitis would lead any mistargeted lysosomal protein to remain longer inside the pancreatic cells, which might have important physiological consequences. Additionally, it is known that in Cer-induced AP a perturbation of protein trafficking occurs, and the altered vesicular traffic in the secretory pathway is involved in vacuole formation [11]. Also, the carbohydrate composition of glycoproteins in the secretory pathway and vacuoles is altered in experimental pancreatitis, indicating that glycoproteins passing through the Golgi complex are not processed normally [10,11]. This might have important cellular implications, since highly glycosylated LAMP proteins coat the inner face of lysosomes, probably protecting this organelle from self- destruction, although this aspect remains unclear [43]. Accordingly, changes in the carbohydrate content of LAMPs might also produce changes in their effectiveness regarding the protection of the lysosomal membrane and/or their role in vacuole disruption and the release of active proteases into the cytosol. Interestingly, LAMP-2 is one of the major carriers of poly-N-acetyllactosamines in cells [41], and its molecular weight increases along with the increase in its polylactosamine glycosylation, a feature that has been observed to be correlated with a longer LAMP-2 residence time in the Golgi complex, irrespective of Golgi integrity [44]. The extension of polylactosamine glycosylation requires the repeated action of two transferases, a glycosyltransferase and a galactosyl transferase, presumably within the same Golgi cisterna [45]. Galactosyl transferase has been localized in trans Golgi cisternae and the overlapping distribution of glycosyltransferases in Golgi cisternae has been already described [45]. All these data might be relevant with respect to the structure of LAMP-2 in our model of Cer-induced AP since, as we have reported above, glycoprotein processing is altered in the Golgi compartment in pancreatitis [10]. Moreover, microtubule disorganization occurs in Cer-induced AP [46], and although the depolymerisation of the microtubule cytoskeleton results in the dispersion of numerous small Golgi clusters, LAMP-2 polylactosamine glycosylation still occurs in these clusters [10]. An intriguing issue is the fact that the 120 kDa LAMP-2 behaves as a soluble-type protein. In this regard, at least in the rat liver it is known that one portion of LAMP-2 is also located in the lysosomal matrix [47,48], whose origin is unclear. Both a direct deinsertion from the lysosomal membrane after conformational change as well as a release by proteolytic cleavage of the short transmembrane and cytosolic tail have been proposed [47]. Furthermore, lipids associated with at least LAMP-2A may also play an important role in lysosomal membrane deinsertion or reinsertion [47]. Several other membrane protein insertions/deinsertions have been described for other type I membrane proteins, sometimes probably driven only by hydrophobic interactions with lipids [49]. Cleavage has also been described for other lysosomal membrane proteins [50]. The origin of the solubility of our 120kDa LAMP-2 form remains to be resolved. In conclusion, this study shows that the pancreatic expression of LAMP-2 is increased during the early phase of Cer-induced AP, although a different post-translational processing in its carbohydrate content, accompanied by cellular missorting, would finally afford a decrease in its expression level in the lysosome. The latter feature links our work to others addressing the relevance of the depletion of lysosomal proteins in pancreatitic acinar cell vacuolization. Our results also appear to offer a starting point for further investigations regarding the biology of the synthesis and post-translational processing of LAMP-2 in experimental pancreatitis, and in Cer-induced AP in particular. References [1] A.K. Saluja , L. Bhagat, H.S. Lee, M. Bhatia, J.L. Frossard, M.L. Steer, Secretagogue-induced digestive enzyme activation and cell injury in rat pancreatic acini, Am. J. Physiol. Gastrointest. Liver Physiol. 279 (1999) G835-G842. [2] R. Alonso, A. Montero, M. Arévalo, L.J. García, C. Sánchez-Vicente, F. Rodríguez-Nodal, J.M. López-Novoa, J.J. Calvo, Platelet-activating factor mediates pancreatic function derangement in caerulein-induced pancreatitis in rats, Clin. Sci. 87 (1994) 85-90. [3] R. Pescador, M.A. Manso, A.J. Revollo, I. De Dios, Effect of chronic administration of hydrocortisone on the induction and evolution of acute pancreatitis induced by cerulein, Pancreas 11 (1995) 165-172. [4] N. Yönetçi, N. Oruç, A.O. Ozütemiz, H.A. Celik, G, Yüce, Effects of mast-cell stabilization in caerulein-induced acute pancreatitis in rats, Int. J. Pancreatol. 29 (2001) 163-171. [5] M. Zhao, D.B. Xue, B. Zheng, W.H. Zhang, S.H. Pan, B. Sun, Induction of apoptosis by artemisin relieving the severity of inflammation in caerulein-induced acute pancreatitis, World J. Gastroenterol. 14 (2007) 5612-5617. [6] N. Sarmiento, M.C. Sánchez-Bernal, M.N. Pérez-González, A. Mangas, J.L. Sardina, J.J. Calvo, J. Sánchez-Yagüe, Rolipram and SP600125 suppress the early increase in PTP1B expression during cerulein-induced pancreatitis in rats, Pancreas 39 (2010) 639-645. [7] W. Halangk, M.M. Lerch, Early events in acute pancreatitis, Clin. Lab. Med. [8] G.J.D. van Acker, G. Perides, M.L. Steer, Co-localization hypothesis: A mechanism for the intrapancreatic activation of digestive enzymes during the early phases of acute pancreatitis, World J. Gastroenterol. 12 (2006) 1985-1990. [9] A.K. Saluja, M.M. Lerch, P.A. Phillips, V. Dudeja, Why does pancreatic overstimulation cause pancreatitis?, Ann. Rev. Physiol. 69 (2007) 249-269. [10] R.C. de Lisle, Altered posttranslational processing of glycoproteins in cerulein-induced pancreatitis, Exp. Cell Res. 308 (2005) 101-113. [11] I. Saito, S. Hashimoto, A. Saluja, M.L. Steer, J. Meldolesi, Intracellular transport of pancreatic zymogens during cerulein supramaximal stimulation, Am. J. Physiol. 253 (1987) G517-G526. [12] K. Furuta, X.L. Yang, J.S. Chen, R. Hamilton, J.T. August, Differential expression of the lysosome-associated membrane proteins in normal tissues, Arch. Biochem. Biophys. 365 (1999) 75-82. [13] Y. Cha, S.M. Holland, J.T. August, The cDNA sequence of mouse LAMP-2. Evidence for two classes of lysosomal membrane glycoproteins, J. Biol. Chem. 265 (1990) 5008-5013. [14] N.R. Gough, D.M. Fambrough, Different steady state subcelular distributions of the three splice variants of lysosome-associated membrane protein LAMP-2 are determined largely by the COOH-terminal amino acid residue, J. Cell Biol. 137 (1997) 1161-1169. [15] T. Braulke, J.S. Bonifacino, Sorting of lysosomal proteins, Biochim. Biophys. Acta. 1793 (2009) 605-614. [16] H. Maeda, K. Akasaki, Y. Yoshimine, A. Akamine, K. Yamamoto, Limited and selective localization of the lysosomal membrane glycoproteins LGP85 and LGP96 in rat osteoclasts, Histochem. Cell Biol. 111 (1999) 245–251. [17] E.L. Eskelinen , A.M. Cuervo, M.R. Taylor, I. Nishino, J.S. Blum, J.F. Dice, I.V. Sandoval, J. Lippincott-Schwartz, J.T. August, P. Saftig, Unifying nomenclature for the isoforms of the lysosomal membrane protein LAMP-2, Traffic 6 (2005) 1058-1061. [18] B. Levine, G. Kroemer, Autophagy in the pathogenesis of disease, Cell 132 (2008) 27-42. [19] E.L. Eskelinen, A.L. Illert, Y. Tanaka, G. Schwarzmann, J. Blanz, K. von Figura, P. Saftig, Role of Lamp-2 in lysosome biogenesis and autophagy, Mol. Biol. Cell. 13 (2002) 3355- 3368. [20] I. Nishino, Autophagic vacuolar myopathies, Curr. Neurol. Neurosci. Rep. 3 (2003) 64-69. [21] Y. Tanaka, G. Guhde, A. Suter, E.L. Eskelinen, D. Hartmann, R. Lüllmann-Rauch, P.M. Janssen, J. Blanz, K. von Figura, P. Saktig, Accumulation of autophagic vacuoles and cardiomyopathy in Lamp-2-deficient mice, Nature 406 (2000) 902-906. [22] F. Fortunato, H. Bürgers, F. Bergmann, P. Rieger, M.W. Büchler, G. Kroemer, J. Werner, Impaired autolysosome formation correlates with Lamp-2 depletion: role of apoptosis, autophagy, and necrosis in pancreatitis, Gastroenterology 137 (2009) 350-360. [23] N. Sarmiento, C. Sánchez-Bernal, M. Ayra, N. Pérez, A. Hernández-Hernández, J.J. Calvo, Sánchez-Yagüe, Changes in the expression and dynamics of SHP-1 and SHP-2 during cerulein-induced acute pancreatitis in rats, Biochim. Biophys. Acta. 1782 (2008) 271-279. [24] C. Sánchez-Bernal, O.H. García-Morales, C. Domínguez, P. Martín Gallán, J.J. Calvo, L. Ferreira, N. Pérez-González, Nitric oxide protects against pancreatic subcellular damage in acute pancreatitis, Pancreas 28 (2004) e9-e15. [25] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248-254. [26] A.P. Clemons, D.M. Holstein, A. Galli, C. Saunders C, Cerulein-induced acute pancreatitis in the rat is significantly ameliorated by treatment with MEK1/2 inhibitors U0126 and PD98059, Pancreas 25 (2002) 251-259. [27] A. Hernández-Hernández, M.N. Garabatos, M.C. Rodríguez, M.L. Vidal, A. López- Revuelta, J.I. Sánchez-Gallego, M. Llanillo, J. Sánchez-Yagüe, Structural characteristics of a lipid peroxidation product, trans-2-nonenal, that favour inhibition of membrane associated phosphotyrosine phosphatase activity, Biochim. Biophys. Acta. 1726 (2005) 317-325. [28] J. de Castro, A. Hernández-Hernández, M.C. Rodríguez, M. Llanillo, J. Sánchez-Yagüe, Comparison of changes in erythrocyte and platelet fatty acid composition and protein oxidation in advanzed non-small cell lung cancer, Cancer Invest. 24 (2006) 339-345. [29] J.F. Dice, Chaperone-mediated autophagy, Autophagy 3 (2007) 295-299. [30] T. Reinheckel, J. Prause, B. Nedelev, W. Augustin, H.-U. Schulz, H. Lippert, W. Halangh, Oxidative stress affects pancreatic proteins during the early pathogenesis of rat cerulein pancreatitis, Digestion 60 (1999) 56-62. [31] B. Künzli, P.O. Berberat, Z.W. Zhu, M. Martignoni, J. Kleeff, A. Tempia-Caliera, M. Fukuda, A. Zimmermann, H. Friess, M.W. Büchler, Influences of the lysosomal associated membrane proteins (Lamp-1, Lamp-2) and Mac-2 binding protein (Mac-2-BP) on the prognosis of pancreatic carcinoma, Cancer 94 (2002) 228-239. [32] J. Mayerle, J. Schnekenburger, B. Kruger, J. Kellermann, M. Ruthenburger, F.U. Weiss, A. Nalli, W. Domschke, M.M. Lerch, Extracellular cleavage of E-cadherin by leukocyte elastase during acute experimental pancreatitis in rats, Gastroenterology 129 (2005) 1251- 1267. [33] B. Ji, X. Chen, D.E. Misek, R. Kuick, S. Hanash, S. Ernst, R. Najarian, C.D. Logsdon, Pancreatic gene expression during the initiation of acute pancreatitis: identification of EGR- 1 as a key regulator, Physiol. Genomics 14 (2003) 59-72. [34] T. Reinheckel, B. Nedelev, J. Prause, W. Augustin, H.-U. Schulz, H. Lippert, W. Halangh, Occurrence of oxidatively modified proteins: an early event in experimental acute pancreatitis, Free Radic. Biol. Med. 24 (1998) 393-400. [35] U. Lichter-Konecki, S.E. Moter, B.R. Krawisz, M. Schlotter, C. Hipke, D.S. Konecki, Expression patterns of murine lysosome-associated membrane protein 2 (Lamp-2) transcripts during morphogenesis. Differentiation 1999; 65: 43-58. [36] J.E. Oertel, The pancreas. Nonneoplastic alterations, Am. J. Surg. Pathol. 13(Suppl 1) (1989) 50-65. [37] C.H. Kubisch CH, C.D. Logsdon, Endoplasmic reticulum stress and the pancreatic acinar cell, Expert Rev. Gastroenterol. Hepatol. 2 (2008) 249-260. [38] G. Hoppe G, J. O´Neil J, H.F. Hoff HF, J. Sears, Products of lipid peroxidation induce missorting of the principal lysosomal protease in retinal pigment epithelium, Biochim. Biophys. Acta. 1689 (2004) 33-41. [39] A. Dabrowski, S.J. Konturek, J.W. Konturek, A. Gabryelewicz, Role of oxidative stress in the pathogenesis of caerulein-induced acute pancreatitis, Eur. J. Pharmacol. 377 (1999) 1- 11. [40] A. Dabrowski, A. Gabryelewicz, M. Chwiecko, Products of lipid peroxidation and changes in sulfhydryl compounds in pancreatic tissue of rats with caerulein-induced acute pancreatitis, Biochem. Med. Metab. Biol. 46 (1991) 10-16. [41] M. Fukuda, Lysosomal membrane glycoproteins. Structure, biosynthesis and intracelular trafficking, J. Biol. Chem. 266 (199) 21327-21330. [42] O. Gilgenast, B. Brandt-Nedelev, I. Wiswedel, H. Lippert, W. Halangk, T. Reinheckel, Differential oxidative injury in extrapancreatic tissues during experimental pancreatitis: modification of lung proteins by 4-hydroxynonenal, Dig. Dis. Sci. 46 (2001) 932-937. [43] N. Andrejewski, E.L. Punnonen, G. Guhde, Y. Tanaka, R. Lullmann-Rauch, D. Hartman, von Figura, P. Saftig, Normal lysosomal morphology and function in LAMP-1-deficient mice, J. Biol. Chem. 274 (1999) 12692-12701. [44] I.R. Nabi, E. Rodriguez-Boulan, Increased LAMP-2 polylactosamine glycosylation is associated with its slower Golgi transit during establishment of a polarized MDCK epitelial monolayer, Mol. Biol. Cell. 4 (1993) 627-635. [45] I.R. Nabi, J.W. Dennis, The extent of polylactosamine glycosylation of MDCK LAMP-2 is determined by its Golgi residence time, Glycobiology 8 (1998) 947-953. [46] T. Ueda, Y. Takeyama, M. Adachi, A. Toyokawa, S. Kishida, M. Yamamoto, Y. Saitoh, Effect of the microtubule-disrupting drug colchicine on rat cerulein-induced pancreatitis in comparison with the microtubule stabilizer taxol, Pancreas 11 (1995) 294-302. [47] M. Jadot M, R. Wattiaux R, F. Mainferme F, F. Dubois F, A. Claessens A, S. Wattiaux-De Coninck, Soluble form of Lamp II in purified rat liver lysosomes, Biochim. Biophys. Res. Commun. 223 (1996) 353-359. [48] A.M. Cuervo, J.F. Dice, Regulation of Lamp2a levels in the lysosomal membrane, Traffic 1 (2000) 570-583. [49] S.L. Rusch, D.A. Kendall, Oligomeric states of the SecA and SecYEG core components of the bacterial Sec translocon, Biochim. Biophys. Acta. 1768 (2007) 5-12. [50] A.M. Cuervo, J.F. Dice, Unique properties of lamp2a compared to other lamp2 isoforms, J. Cell Sci. 113 (2000) 4441-4450. Conclusiones 1.- La obtención de un método para la separación de diferentes poblaciones de lisosomas pancreáticos usando una combinación de centrifugación diferencial y un gradiente discontinuo de Percoll, ha permitido demostrar que la pancreatitis aguda inducida por ceruleína está asociada a cambios en la morfología y tamaño de los orgánulos de dichas poblaciones. 2.- La dinámica de las formas moleculares de la N-acetilglucosaminidasa revela una alteración de la integridad de la membrana de los lisosomas primarios y es un indicador adicional del daño en dicha membrana, asociado a la pancreatitis aguda. 3.- El incremento en la expresión de SHP-1 y SHP-2, así como los cambios en la distribución subcelular de SHP-2, son sucesos tempranos en el desarrollo de la pancreatitis aguda inducida por ceruleína. 4.- El aumento en la expresión de SHP-2 en tres modelos diferentes de pancreatitis in vivo, indica una importancia general de esta fosfatasa en la pancreatitis aguda. 5.- Las MAPKs JNK y ERK ½, así como los niveles de AMPc intracelular modulan de diferentes modos la expresión de SHP-1 y SHP-2. 6.- El incremento en la expresión de PTP1B es un suceso temprano en el desarrollo de la pancreatitis aguda inducida por ceruleína, en el cual, la infiltración por neutrófilos parece jugar un papel relevante. 7.- En la fase temprana de la pancreatitis aguda inducida por ceruleína, el aumento en los niveles de AMPc intracelular en las células inflamatorias, así como la inhibición de JNK y ERK ½, previenen, principalmente, el incremento en la expresión de PTP1B. 8.- Expresión de LAMP-2 aumenta durante la fase temprana de la pancreatitis aguda inducida por ceruleína, aunque un diferente procesado post- transcripcional de su contenido en glúcidos, acompañado de una deslocalización subcelular de la proteína en la patología, finalmente conduciría a su disminución en el lisosoma.
© 2001-2026 Fundación Dialnet · Todos los derechos reservados