Enhancement of ligninolytic enzyme activities in a Trametes maxima-Paecilomyces carneus co-culture: Key factors revealed after screening using a Plackett-Burman experimental design

 

Wilberth Chan Cupul^a, Gabriela Heredia Abarca^a, Daniel Martínez Carrera^b, Refugio Rodríguez Vázquez^c*

^a Laboratorio de Micromicetos, Red de Biodiversidad y Sistemática, Instituto de Ecología A.C., Xalapa, Veracruz, México.
^b Biotecnología de Hongos, Colegio de Postgraduados, Campus Puebla, Puebla, México.
^c Departamento de Biotecnología y Bioingeniería, Centro de Investigación y de Estudios Avanzados, Instituto Politécnico Nacional, México D.F., México.

---

ABSTRACT

Background

In the industrial biotechnology, ligninolytic enzymes are produced by single fungal strains. Experimental evidence suggests that co-culture of ligninolytic fungi and filamentous microfungi results in an increase laccase activity. In this topic, only the ascomycete Trichoderma spp. has been studied broadly. However, fungal ligninolytic-filamentous microfungi biodiversity interaction in nature is abundant and poorly studied. The enhancement of laccase and manganese peroxidase (MnP) activities of Trametes maxima as a function of time inoculation of Paecilomyces carneus and under several culture conditions using Plackett-Burman experimental design (PBED) were investigated.

Results

The highest increases of laccase (12,382.5 U/mg protein) and MnP (564.1 U/mg protein) activities were seen in co-cultures I3 and I5, respectively, both at 10 d after inoculation. This level of activity was significantly different from the enzyme activity in non-inoculated T. maxima (4881.0 U/mg protein and 291.8 U/mg protein for laccase and MnP, respectively). PBED results showed that laccase was increased (P < 0.05) by high levels of glucose, (NH₄)₂SO₄ and MnSO₄ and low levels of KH₂PO₄, FeSO₄ and inoculum (P < 0.05). In addition, MnP activity was increased (P < 0.05) by high yeast extract, MgSO₄, CaCl₂ and MnSO₄ concentrations.

Conclusions

Interaction between indigenous fungi: T. maxima-P. carneus improves laccase and MnP activities. The inoculation time of P. carneus on T. maxima plays an important role in the laccase and MnP enhancement. The nutritional requirements for enzyme improvement in a co-culture system are different from those required for a monoculture system.

Keywords: Enzyme activity enhance; Fungal interaction; Paecilomyces carneus; Time inoculation; White-rot fungi.

---

 

1. Introduction

White-rot fungi can offer a biological and environmentally friendly means of reducing environmental pollution by ligninolytic enzymes, such as laccase (EC 1.10.3.2), manganese peroxidase (MnP) (EC 1.11.1.14) and lignin peroxidase (EC 1.11.1.13), which degrade a wide range of environmental pollutants [1,2,3]. Most of the fungal enzymes in industrial biotechnology today are produced by processes involving single microbial strains [4]. However, constitutive extracelullar enzymes from white-rot fungi are only produced in small amounts, so their use in industrial applications has been limited due to low productivity and high economic cost [5,6]. Chemical induction of laccase and MnP by the addition of compounds related to lignin or lignin derivates, phenolic and aromatic compounds, copper, ethanol and contaminated water has been studied [7,8]. However, chemical inducers are expensive and, in some cases, toxic. Therefore, the search for economical and safe laccase and MnP production methods has been one of the main enzyme research topics in the past few decades [5]. Using co-cultures appears to be more successful than using single microorganism cultures, because of the potential to utilize synergisms between the metabolic pathways of the strains involved in the co-culture [4,9]. Previous studies have shown that co-cultivation of some white-rot fungi, such as Lentinula edodes, Pleutotus ostretus, Trametes versicolor and Phanerochaete chrysosporium, with the filamentous fungi, Trichoderma spp., resulted in high laccase production [5, 10, 11, 12, 13, 14]. In these cases, only the interactions with the microfungi Trichoderma spp., were studied, which is considered an antagonic fungus against edible mushrooms [13] and a fungus with a biological control potential [15].

The mechanism used to enhance laccase activity of white-rot fungi during co-culture with Trichoderma spp. is not known [4, 12]. Some authors have suggested that the increased laccase activity of white-rot fungi could be a response against Trichoderma spp. attack [5, 13], due to the synthesis of lytic enzymes, such as chitinase and β-1,3-glucanases, in the mycoparasitism process [16, 17]. This hypothesis has arisen because the increased production of laccase occurred when cultures of white-rot fungi were infected with Trichoderma spp. mycelia, which seemed to lead to an increase in the production of laccase and lytic enzymes by Trichoderma spp. [13, 18]. This occurred during antagonism with white-rot fungi strains, and is mainly associated with host cell degradation. Some authors have suggested that laccase production under Trichoderma spp. attack is a defense response by white-rot fungi [17, 19].

Co-culture of white-rot fungi with soil microfungi has been little studied. Moreover, the effect of the fungi inoculation time on the development of co-cultures and the optimum culture conditions needed to increase enzyme activities have also not been studied to any great extent. Maximum culture condition can be determinated through experimental designs, one of this is the Placket-Burman experimental design (PBED), which is focused in identifying main effects on efficiency, and it uses few experimental trials for large number of factors [20]. This design has been used to study the influence of laccase activity mainly in monocutures of white-rot fungi [21,22]. Therefore, this study was undertaken in order to evaluate: a) the production of laccase and MnP in co-cultures of the Mexican native white-rot fungus, Trametes maxima, and the filamentous soil microfungus, Paecilomyces carneus; b) investigate whether the development of the co-cultures, with or without inoculation with the soil microfungus, has an effect on enzyme activity increase and c) investigate different culture conditions using a PBED.

2. Materials and methods

2.1. Isolation of strains

Carpophores of Trametes spp. were collected in Vega del Pixquiac, San Ándres Tlalnelhuayocan, Veracruz, Mexico (location: 19°32'21.23?, 97°00'47.29?). In order to obtain the strain of Trametes spp., 0.5-1 cm fragments from the carpophores were washed in ethanol (70%) for 1 min, then in sodium hypochlorite (50%) for 3 min and finally in sterile distilled water. The washed and disinfected fragments were placed on potato-dextrose agar (PDA, BD Bioxon, Mexico) plates, supplemented with chloramphenicol (20 mg/L) (Sigma, st. Louis, MO, USA) in order to prevent bacterial contamination, and benomyl (3 mg/L) (Biesterfeld Co., Mexico), which inhibited mold growth. The soil microfungus, Paecilomyces spp., was isolated by Heredia and Arias [23] from an andic acrisol soil (texture: loam-silt loam) found on a coffee plantation located in Huatusco, Veracruz, Mexico (location: 19°12'57?, 96°53'7?).

The carpophores of Trametes spp. and the strain of Paecilomyces spp. were deposited in the herbarium (XAL) and in the Culture Collection of Micromicetos of the Instituto de Ecología A. C. Xalapa, Veracruz, Mexico. The studied strains were maintained and subcultured in PDA.

2.2. Molecular identification

The mycelia of the studied strains was grown in sterile petri dishes containing liquid complete yeast extract medium (standard CYM: dextrose, 20 g; peptone, 2 g; yeast extract, 2 g; MgSO₄ × 7 H₂O, 0.5 g; KH₂PO₄, 0.46 g; K₂HPO₄, 1 g; distilled water: 1000 mL), and incubated at 25°C. The mycelia were harvested using a sterile spatula, dried by squeeze-blotting between filter papers (Whatman, no. 1), placed in Eppendorf tubes (1.5 mL) and frozen in liquid nitrogen vapor (-130°C). The Eppendorf tubes were then freeze-dried overnight using vacuum apparatus (Labconco, Freezone 4.5, Kansas, Missouri, USA). Genomic DNA extraction and purification of the dried mycelial samples were carried out using Qiagen columns (Qiagen GmbH, Hilden, Germany), according to the methodology developed by Challen et al. [24].

DNA concentration and purity were determined by comparative agarose gel electrophoresis (1.5%), and ethidium bromide staining. PCR amplifications of the ITS1-5.8S-ITS2 region were carried out using the following primers: ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) [25]. Each amplification reaction (50 µL) contained: the master mix, 25 µL (AmpliTaq Gold PCR kit, Applied Biosystems, Foster, CA, USA), ITS-1 primer (10 µM, 5 µL), ITS-4 primer (10 µM, 5 µL), template DNA (50 ng, 2 µL) and PCR water (13 µL). All amplification reactions were performed using a Gene Amp PCR System 9700 thermal cycler (Applied Biosystems, Foster, CA, USA). The temperature cycling protocol consisted of one initial denaturation cycle at 95°C for 1 min, followed by 25 cycles of 94°C for 30 s, 50°C for 45 s, 72°C for 5 min and a final cycle of 72°C for 5 min. The amplification products were analyzed by electrophoresis in 1.5% agarose gels, containing ethidium bromide, and purified using a QIAquick PCR Purification Kit (Qiagen GmbH, Hilden, Germany) [26].

The purified PCR products were sequenced by SeqWright DNA Technology Services (Houston, Texas, USA). Each sample was sequenced in both directions. DNA sequence analyses were performed using the basic sequence alignment BLAST program, run against the NCBI database (www.ncbi.nlm.nih.gov). The Index Fungorum (www.indexfungorum.org) was used as a species authority.

2.3. Selection of the medium for co-culturing

In order to select the best medium for improving laccase and MnP activities by the T. maxima-P. carneus co-culture, the following three culture media were tested: Sivakumar et al. [27], Koroljova et al. [28] and Bose et al. [29]. The Sivakumar medium contained (g/L): glucose (20), yeast extract (2.5), KH₂PO₄ (1.0), (NH₄)₂SO₄ (0.05), MgSO₄ (0.5), CaCl₂ (0.01), FeSO₄ (0.01), MnSO₄ (0.001), ZnSO₄ (0.001) and CuSO₄ (0.002). The Koroljova medium contained (g/L): glucose (10), peptone (3), KH₂PO₄ (0.6), ZnSO₄ (0.001), K₂HPO₄ (0.4), FeSO₄ (0.0005), MnSO₄ (0.05) and MgSO₄ (0.5). Finally the Bose medium contained (g/L): glucose (20), KH₂PO₄ (1.5), CaCl₂ (0.37), ZnSO₄ (0.3), MgSO₄ (0.5), (NH₄)₂SO₄ (1) yeast extract (5) and peptone (2). All these culture media were adjusted to pH 4.5 (all reagents were purchased from J. T. Baker, Center Valley, PA, USA). Four mycelial disks (5 mm Ø) were taken from the active borders of the T. maxima PDA cultures (7 d old) and transferred to Erlenmeyer flasks (250 mL) containing 120 mL of one of the culture media. The flasks were incubated on a rotating shaker (120 rpm) at 25 ± 1°C for 12 d. There were four replicates for each evaluated culture medium. Culture samples were collected at regular intervals of 24 h and centrifuged (10,000 × g, for 10 min), the supernatant was used for enzyme activities and protein content measurements.

2.4. Enzyme and protein assay

Laccase activity was determined by measuring the oxidation of 2,2'-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) at room temperature (25-27°C) in a reaction mixture containing 5.0 mM ABTS (Sigma, St. Louis, MO, USA) and 100 mM acetate buffer (pH 4.5). Absorbance changes in the presence of the enzyme were monitored for 5 min at 420 nm (e = 3.6 × 10⁴ M^- 1 cm^- 1) [30]. One unit of laccase activity (U) was defined as the amount of enzyme required to oxidize 1 µmol ABTS/mL/min, laccase activities in the extract were expressed as a specific enzyme activity (U/mg protein).

MnP activity was measured according to Glenn and Gold [31]. The reaction mixture contained 25 mM sodium lactate (50 µL), 2 mM MnSO₄ (50 µL), 0.1% egg albumin (50 µL), 0.2% phenol red (50 µL) and 0.7 mL culture filtrate in 20 mM lactate-succinate buffer (50 µL, pH 4.5). The reaction was started with the addition of 2 mM H₂O₂ (50 µL) in a total volume of 1 mL and stopped after 5 min by the addition of NaOH (50 µL, 2 N). The absorption at 610 nm was measured against a blank without any manganese in the reaction mixture. The molar extinction coefficient of the oxidized phenol red is 22 mM^- 1 cm^- 1. One unit of MnP activity (U) is the amount of enzyme needed to form 1 µmol of oxidized phenol red/mL/min, MnP activities in the extract were expressed as specific enzyme activity (U/mg protein).

The protein content of the culture extracts was estimated according to the method used by Bradford [32] and BSA was used as a standard at known concentrations (0.0062, 0.0125, 0.025, 0.05, 0.1 and 0.2 mg/mL). The standard curve was: y = 0.1615c - 0.0125 (y = OD₅₉₅, c = protein concentration in mg/mL, R² = 0.998).

2.5. Establishment of the co-culture

To estimate the effect of the P. carneus inoculation time on laccase and MnP activities, co-culturing with simultaneous (I0) and outdate inoculation were performed. For co-cultures with outdate inoculations, the mixed cultures were established by adding the filamentous microfungus P. carneus after 3 d (I3) and 5 d (I5) of T. maxima growth. Two monocultures: T. maxima and P. carneus were used as a control. The co-cultures were established in Erlenmeyer flasks (250 mL) with 120 mL of Sivakumar culture medium, which was the medium that was finally selected after testing. The T. maxima and P. carneus were inoculated with four mycelial agar disks (5 mm Ø) of active mycelia. All treatments, including the controls, were replicated four times. The co-cultures were incubated for 12 d under the same conditions mentioned previously. Laccase and MnP activities and protein content were evaluated daily.

2.6. Screening of important factors in enzyme activities under PBED

The PBED is a statistical technique used for screening experimental factors [20]. In this study the technique was used to identify the significant factors that had an impact on the laccase and MnP activities in T. maxima-P. carneus co-culture. The statistical screening was based on the main effects of the experimental factors, but not on their interaction effects. The Sivakumar medium was modified to test the influence of different factors for enzyme activities. Eleven factors were assessed: the components of Sivakumar medium (10 nutrients) and the inoculum amount (mycelial agar disks of T. maxima) ( Table 1). Each factor was tested at two levels (coded): high level (+ 1) and a low level (-1), and four central points (0) were screened by running 16 experiments, as shown in Table 2. The factors which were significant at the 5% level (P < 0.05) from the regression analysis were considered to have a high impact on laccase and MnP activities. The experimental data were fitted according to [ Equation 1], which includes the individual effects of each variable.

Y=β₀+∑β_iX_i(i=1,2,3······k)$\mathit{}\left(\mathrm{}\right)$ [Equation 1]

where:

Y response (enzyme activity),
β₀ model intercept,
β_i estimated variable.

Table 1. Variables and their levels for laccase and MnP activities under a PBED.

Code Variable Low level (-1) Level 0 High level (+ 1) G Glucose (g/L) 10.0 20.0 30.0 Ye Yeast extract (g/L) 1.25 2.5 3.75 K KH2PO4 (g/L) 0.5 1.0 1.5 N (NH4)2SO4 (g/L) 0.025 0.05 0.075 Mg MgSO4 (g/L) 0.25 0.5 0.75 Ca CaCl2 (g/L) 0.005 0.01 0.015 Fe FeSO4 (g/L) 0.005 0.01 0.015 Mn MnSO4 (g/L) 0.0005 0.001 0.0015 Zn ZnSO4 (g/L) 0.0005 0.001 0.0015 Cu CuSO4 (g/L) 0.001 0.002 0.003 I Inoculum (mycelial disks) 2.0 4.0 6.0

Table 2. PBED matrix for evaluating factors influencing laccase and MnP activities (U/mg protein) in the T. maxima-P. carneus co-culture.

Order Run G Ye K N Mg Ca Fe Mn Zn Cu I Laccase MnP Observed Predicted Observed Predicted 1 8 + 1 + 1 -1 + 1 + 1 + 1 -1 -1 -1 + 1 -1 33,331.4 33,008.9 638.4 598.3 2 10 -1 + 1 + 1 -1 + 1 + 1 + 1 -1 -1 -1 + 1 1785.9 1768.6 434.8 407.5 3 15 + 1 -1 + 1 + 1 -1 + 1 + 1 + 1 -1 -1 -1 16,022.9 15,867.9 260.8 244.4 4 13 -1 + 1 -1 + 1 + 1 -1 + 1 + 1 + 1 -1 -1 25,461.7 25,215.3 328.8 308.1 5 4 -1 -1 + 1 -1 + 1 + 1 -1 + 1 + 1 + 1 -1 13,374.0 13,244.6 220.9 207.0 6 14 -1 -1 -1 + 1 -1 + 1 + 1 -1 + 1 + 1 + 1 7037.8 6969.7 50.7 47.5 7 1 + 1 -1 -1 -1 + 1 -1 + 1 + 1 -1 + 1 + 1 14,621.2 14,479.7 216.5 202.8 8 5 + 1 + 1 -1 -1 -1 + 1 -1 + 1 + 1 -1 + 1 16,625.1 16,464.3 371.8 348.4 9 2 + 1 + 1 + 1 -1 -1 -1 + 1 -1 + 1 + 1 -1 12,513.7 12,392.6 211.5 198.2 10 6 -1 + 1 + 1 + 1 -1 -1 -1 + 1 -1 + 1 + 1 13,098.5 12,971.8 177.5 166.3 11 12 + 1 -1 + 1 + 1 + 1 -1 -1 -1 + 1 -1 + 1 13,085.8 12,959.2 84.1 78.8 12 7 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 8082.8 8004.6 88.4 82.8 13 3 0 0 0 0 0 0 0 0 0 0 0 12,113.5 11,960.7 155.3 193.4 14 16 0 0 0 0 0 0 0 0 0 0 0 11,942.8 11,960.7 147.9 193.4 15 11 0 0 0 0 0 0 0 0 0 0 0 13,547.5 11,960.7 217.9 193.4 16 9 0 0 0 0 0 0 0 0 0 0 0 9292.4 11,960.7 128.6 193.4

2.7. Data analysis

The selection of culture media and co-cultures was performed using four replicates. The differences among treatments were evaluated by analysis of variance (ANOVA) and a least significant difference (LSD) means comparison (P = 0.05) using GraphPad InStat. The results of the PBED were transformed by natural logarithm and analyzed using the software Design-Expert, ver. 8.1, Stat-Ease Inc., Minneapolis, MN, USA.

3. Results

3.1. Isolation and molecular identification

Fungi were isolated in Veracruz State, Mexico and identified at the molecular level. According to the sequence analysis, the ligninolytic fungus was identified as T. maxima (Mont.) (A. David & Rajchenb) with 99% similarity to the accessions: JN164957.1 and JN164932.1 [33]. In the same manner, the soil microfungus was identified as P. carneus (Duché & R. Heim) A.H.S. Br. & G. Sm. with 98% similarity to the accessions: AB258369.1 [34], DQ888728.1 [35] and FN394726.1 [36]. Both DNA sequences were deposited in the GenBank under the accession numbers: HF947516 (T. maxima) and HF947521 (P. carneus).

3.2. Selection of the medium for co-culturing

Laccase and MnP activities in T. maxima were assessed in three culture media. The greatest laccase activity was found in Sivakumar medium (4560.9 U/mg protein) after 7 d of growth and was significantly (P = 0.005) higher than the Koroljova (302.2 U/mg protein) and Bose (12.1 U/mg protein) culture media. MnP activity was enhanced significantly (P = 0.0003) in Sivakumar medium (477.9 U/mg protein) on the 7th d of culturing and was higher than in the Bose (1.3 U/mg protein) and Koroljova (37.3 U/mg protein) culture media. Therefore, the Sivakumar culture medium was selected for use in the subsequent experiments.

3.3. Enzyme activity of T. maxima-P. carneus co-culture

The time at which T. maxima was inoculated with P. carneus had a significant effect on laccase activity ( Table 3). The best time for inoculation with P. carneus was 3 d after T. maxima was established (I3). It had a maximum activity (12,382.5 U/mg protein) that was higher (P = 0.0001) than the monoculture (488.0 U/mg protein) and co-cultures: I0 (573.3 U/mg protein) and I5 (5,944.8 U/mg protein), on the 10th d.

Table 3. Kinetic of laccase and MnP specific activity (U/mg protein) in T. maxima-P. carneus co-cultures, inoculated at 0, 3 and 5 d.

Culture Time (d) Laccase activity (U/mg protein) MnP activity (U/mg protein) T. maxima monoculture Co-culture I0 (0 d) Co-culture I3 (3 d) Co-culture I5 (5 d) T. maxima monoculture Co-culture I0 (0 d) Co-culture I3 (3 d) Co-culture I5 (5 d) 1 6.35 b 28.97 a     n.d. n.d.     2 6.12 b 75.82 a     15.75 a 13.02 a     3 5.45 b 298.10 a P. c. inoculation   18.87 b 141.35 a P. c. inoculation   4 62.6 b 1107.43 a 184.42b   16.19 b 43.96 b 118.95 a   5 673.82 b 2301.75 a 1648.88 a P. c. inoculation 16.28 c 106.44 b 242.81 a P. c. inoculation 6 3962.43 b 3950.43 b 6724.65 a 1653.30 c 89.39 b 29.75 c 306.78 a n.d. 7 4404.00 b 3860.92 b 8290.23 a 5118.93 b 116.97 b 118.24 b 207.10 a 117.64 b 8 4218.82 b 1073.90 c 6841.07 a 6183.57 ab 368.63 a 81.83 b 487.26 a 401.98 a 9 4127.48 b 832.10 c 8574.45 a 4811.15 b 460.97 a 23.99 b 552.51 a 444.26 a 10 4881.07 b 573.38 c 12,382.5 a 5944.85 b 291.80 b 9.07 c 417.43 b 564.12 a 11 4392.95 b 544.80 c 8949.80 a 3901.63 b 309.88 a n.d. 400.05 a 294.90 a 12 4506.93 b 431.17 c 7243.88 a 4636.12 b 248.66 a n.d. 233.57 a 220.63 a

Bold script indicates values significantly different from T. maxima monoculture (LSD, P < 0.05); n.d. = no detected. Co-culture I0 = T. maxima cultures inoculated at the same time with P. carneus. Co-culture I3 = T. maxima cultures inoculated with P. carneus 3 d after settling T. maxima in the culture medium. Co-culture I5 = T. maxima cultures inoculated with P. carneus 5 d after settling T. maxima in the culture medium.

The MnP activity showed a maximum activity (564.1 U/mg protein) on the 10th d in co-culture I5, which was higher (P = 0.002) than the monoculture (291.8 U/mg protein), and the co-cultures: I0 (9.0 U/mg protein) and I3 (417.4 U/mg protein). With regard to MnP maximum activity, 5 d after T. maxima establishment was the best time to inoculate P. carneus in the co-culture. No laccase activity was detected in P. carneus culture.

3.4. Screening of important factors in enzyme activities under PBED

The data in Table 2 indicate that, there was a wide variation in laccase and MnP activities during the 16 runs. This variation reflects the importance of medium optimization if high enzyme activity yields are to be realized. During the kinetics, the highest laccase activity (33,331.4 U/mg protein) was seen in the 8th trial run, whereas the lowest activity (1,785 U/mg protein) was seen in the 10th trial run. There was a 1.8-fold increase in laccase activity in the 8th trial run compared to the central points (runs: 3, 16, 11 and 9) and was improved by high glucose (30 g/L), (NH₄)₂SO₄ (0.075 g/L) and MnSO₄ (0.0015 g/L) concentrations and low KH₂PO₄ (0.5 g/L), FeSO₄ (0.005 g/L) concentrations and inoculum amount (two mycelial disks) (Fig. 1).

Fig. 1. Pareto chart of eleven-factors standard effects on laccase activity in T. maxima-P. carneus co-culture.

The P-value was used to evaluate the significant factors and parameters when the confidence levels were greater than 95%. Glucose (P = 0.006), KH₂PO₄ (P = 0.02), (NH₄)₂SO₄ (P = 0.01), FeSO₄ (P = 0.02), MnSO₄ (P = 0.01) and inoculum amount (P = 0.01) had significant influences on laccase activity (Table 4). The polynomial equation for laccase activity is represented by [ Equation 2]. The significance of [ Equation 2] was checked using a F-test and the value was highly significant [(P-value > F) = 0.017]. Coefficient R² indicates the variability of the predicted response compared to the experimental results ( Table 2). The predicted response in the model becomes more reliable as R² approaches one. The R² of the model [ Equation 2] was 0.986, which indicated that 98.6% of the variability in the experimental data could be explained by the estimated model. Furthermore, the adjusted determination coefficient (Adj. R²) was high (95%) and that confirmed that the model was highly significant. Additionally, this model had a low coefficient of variation (1.51%).

[Equation 2]

Table 4. Analysis of variance for laccase activity.

Source Sum of squares d.f. Mean square F-ratio P-value Percentage P (%) Glucose (G) 1.23 1 1.23 48.72 0.006 20.51 Yeast extract (Ye) 0.027 1 0.027 1.07 0.38 0.45 KH2PO4 (K) 0.59 1 0.59 23.28 0.02 9.80 (NH4)2SO4 (N) 0.92 1 0.92 36.47 0.01 15.36 MgSO4 (Mg) 0.017 1 0.017 0.65 0.49 0.28 CaCl2 (Ca) 0.18 1 0.18 7.05 0.08 2.97 FeSO4 (Fe) 0.48 1 0.48 18.83 0.02 7.93 MnSO4 (Mn) 0.99 1 0.99 39.03 0.01 16.43 ZnSO4 (Zn) 0.18 1 0.18 7.26 0.07 3.06 CuSO4 (Cu) 0.26 1 0.26 10.30 0.05 4.34 Inoculum (I) 1.06 1 1.06 41.67 0.01 17.54 Residual 0.076 3 0.025     1.33 Total (corrected) 6.02 15       100

Regarding to the MnP activity, the maximum value was seen in the 8th trial run (638.4 U/mg protein), as was found for the laccase activity. However, the lowest value was found in the 14th trial run (50.7 U/mg protein). There was a 2.9-fold increase in MnP activity in the 8th trial run compared to the central points (runs: 3, 16, 11 and 9). According to the Pareto chart (Fig. 2), the MnP activity was improved by high concentrations of yeast extract (3.75 g/L), MgSO₄ (0.75 g/L), CaCl₂ (0.015 g/L) and MnSO₄ (0.0015 g/L).

Fig. 2. Pareto chart of eleven-factors standard effects on MnP activity of the T. maxima-P. carneus co-culture.

The yeast extract (P = 0.01), MgSO₄ (P = 0.03), CaCl₂ (P = 0.04) and MnSO₄ (P = 0.04) had significant effects on MnP activity ( Table 5). The polynomial [ Equation 3] was obtained from the multiple regression analysis and describes the effect of the culture conditions on MnP activity. The statistical significance of [ Equation 3] was checked using a F-test [(P-value > F) = 0.043] and the R² and Adj. R² were close to one (R² = 0.94 and Adj. R² = 0.79).

[Equation 3]

Table 5. Analysis of variance for MnP activity.

Source Sum of squares d.f. Mean square F-ratio P-value Percentage P (%) Glucose (G) 0.42 1 0.42 8.43 0.06 6.67 Yeast extract (Ye) 2.61 1 2.61 52.25 0.01 41.34 KH2PO4 (K) 1.56E4 1 1.56E4 0.003 0.96 0.002 (NH4)2SO4 (N) 0.13 1 0.13 2.60 0.21 2.06 MgSO4 (Mg) 0.81 1 0.81 16.14 0.03 12.77 CaCl2 (Ca) 0.62 1 0.62 12.32 0.04 9.75 FeSO4 (Fe) 4.15E3 1 4.15E3 0.083 0.79 0.07 MnSO4 (Mn) 0.52 1 0.52 10.43 0.04 8.25 ZnSO4 (Zn) 0.45 1 0.45 8.90 0.06 7.04 CuSO4 (Cu) 0.027 1 0.027 0.55 0.51 0.43 Inoculum (I) 0.38 1 0.38 7.65 0.07 6.06 Residual 0.15 3 0.050     5.57 Total (corrected) 6.32 15       100.00

4. Discussion

Enzymatic activity in the genus Trametes has been widely studied. However T. maxima, although in the genus Trametes, has not been studied to any great degree. Laccase and MnP activities in T. maxima were influenced by the culture media; the best culture medium was Sivakumar, which achieved maximum laccase and MnP activities on the 7th d of incubation. In contrast, the Bose medium was the worst. The Bose medium was different from Sivakumar medium because it lacked CuSO₄, FeSO₄ and MnSO₄; it is well known that these metal ions play an important role in laccase synthesis and activity  [37]. Kumarasamy et al. [38] suggested that low amounts (< 1 mM) of Cu^2 + and Fe^2 +, like those present in the Sivakumar medium, enhance laccase activity in white-rot fungi. Moreover, the Sivakumar medium showed a 14- and 12-fold increase in laccase and MnP activities, respectively compared with the Koroljova medium. This significant difference could be due to the absence of Cu^2 + and low amounts of glucose (10 g/L) and Fe^2 + (0.0005 g/L) in the Koroljova medium.

The laccase activity of T. maxima (4,560.9 U/mg protein or 16,433.9 U/L) was higher than has been seen in other strains of T. maxima previously studied by Songulashvili et al. [39] and Elisashvili et al. [37] (13,500 U/L and 8600 U/L, respectively). Other species of Trametes have shown a low laccase activity compared with T. maxima, for example: T. versicolor [40], Trametes pubescens [41], Trametes ochracea [37] and Trametes trogii [42] (1200 U/L, 750 U/L, 3900 U/L and 14,200 U/L, respectively).

The highest MnP activity was found in Sivakumar culture medium, this could be due to low yeast extract and Mn^2 + concentrations; previously Kamitsuji et al. [43] reported that a high MnP activity in ligninolytic fungi occurred when the yeast extract (2 g/L) concentration in the culture medium was low. In other studies, Songulashvili et al. [39] found a low MnP activity (460 U/L) in T. maxima when using different waste/by-products from the food industry to stimulate MnP activity and Elisashvili et al. [37] found a low MnP activity (610 U/L) in T. maxima when using a culture medium supplemented with mandarin peel. MnP activity in T. maxima (477.9 U/mg protein or 1700.8 U/L) was higher in this study than has been reported in other Trametes spp. such as, T. versicolor [44], Trametes zonata [39], and Trametes unicolor [37] with 150, 360, 420 and 590 U/L, respectively.

The ligninolytic enzymes in Trametes spp. are highly regulated by several nutrients, such as: glucose, nitrogen and metal ions (Cu^2 +, Mg^2 +) [43], and their production is also affected by many typical fermentation factors, such as: medium composition and type, concentrations of the carbon and nitrogen sources, pH, temperature and the presence of inducers (2,5-xylidine, ethanol, veratryl alcohol, polychlorinated biphenyls, etc.) [40]. However, the biology of the fungus is the most important factor in ligninolytic enzyme production because ligninolytic metabolism is strain-dependent. This means that the selection of new strains with significant laccase or MnP activity is possible [4].

Recently there has been an increased interest in producing white-rot fungal enzymes in co-culture with microorganism, specifically with soil microfungi [4]. However, few studies have been undertaken [9,12,13,18,19]. Therefore, this study investigated the improvement of laccase and MnP activities in T. maxima by the inoculation of P. carneus in a co-culture system. The results showed that laccase and MnP activities were affected by the time of inoculation of P. carneus on the T. maxima cultures. Inoculation of both fungi simultaneously (I0) only enhanced laccase activity to a high extent during the first five days. On the 6th and 7th d, the laccase activity did not decrease, but was statistically lower than the laccase activity found in the control (T. maxima monoculture).

With regard to the MnP activity in the co-culture I0, it was higher only on the first 3 d after inoculation. Thereafter, only low MnP activities were detected. This effect could be due to increased biomass accumulation and nutrient consumption in co-culture I0, compared to the monoculture. A similar effect was described by Flores et al. [14] in co-cultures of Pleurotus ostreatus with Trichoderma viride when they were simultaneously inoculated.

The greatest increase in enzyme activity was when T. maxima were inoculated with P. carneus on the third day of growth (co-culture I3). The laccase activity was significantly higher in comparison to the monoculture from the 5th to the 12th d and the maximum activity was found on the 10th d when the activity was 1.5 times higher than the T. maxima monoculture. The MnP activity increased between d 4th-7th of incubation. On the other days, the MnP activity in co-culture I3 was less than or equal to the control. Co-culture I5 did not induce laccase activity and only on the 10th d did the MnP activity increase by 0.9 times compared to the control. Laccase increases caused by P. carneus-T. maxima co-culture I3 lasted for 7 d, which was similar to previous results reported by Baldrian [12], who found laccase increases after 3, 8, 10, 12, and 14 d for T. versicolor in co-culture with Trichoderma harzianum, Acremonium sphaerospermum, Fusarium reticulatum, Humicola grisea and Penicillium rugulosum, respectively. The inoculation of the microfungi was made on the 11th d of T. versicolor establishment and the increase varied from 1.5 to 49 times, compared to the control. Despite this increase, the levels of laccase activity in these co-cultures (12.0-223.2 U/L) were lower than that produced by T. maxima-P. carneus co-culture I3 (12,382.5 U/mg protein or 27,033.7 U/L).

The use of co-cultures in laccase activity induction is an environmentally safe and low cost strategy. Several attempts have been made to increase laccase activity by co-culturing white-rot fungi with an antogonic fungi. The laccase activities of L. edodes [10], T. versicolor [12], Pleurotus eryngii [45], P. ostreatus [5, 46], Pleurotus pulmonarius, Pleurotus djamor [13] and Trametes spp. [19] were improved when they were co-cultured with Trichoderma spp. However, the laccase yields in these studies were relatively low in comparison with those obtained in this study.

The induction of MnP in co-culture systems has been less studied than laccase. Only Chi et al. [47] and Qi-He et al. [45] have found MnP induction in P. ostreatus-Ceriporiopsis subvermispora (7.3 times increase, 250 nkat/L) and P. ostreatus-Phlebia radiata (1 times increase, 800 nkat/L) co-cultures, respectively. However the fungi used in their co-cultures were not soil microfungi, which probably led to the low MnP induction. The interactions between different microorganism play a critical role in co-cultures because cell growth by one species could enhance or inhibit the enzyme activities of the other strain present in the medium [19]. Therefore, it is necessary to study other genera and species of soil microfungi in co-culture systems in order to find those that are able to induce laccase activity in white-rot fungi.

The PBED is a statistical method used to select culture parameters and it has been proved to be a powerful and useful tool in biotechnology [21,22]. This study has undertaken the first screening of important factors affecting laccase and MnP induction in a co-culture system. The main effects by 11 independent factors were screened in co-culture I3. The results of the PBED experiment demonstrated that glucose, KH₂PO₄, (NH₄)₂SO₄, FeSO₄, MnSO₄ concentrations and inoculum amount had significant effects on laccase activity in the co-cultures. In order of significance for the variables affecting laccase activity, the glucose and the inoculum amount had the most significant effect on laccase activity in T. maxima-P. carneus co-cultures according to the P > F values.

The laccase yield slightly increased as the glucose concentration rose in the culture medium and the yield slightly increased as the inoculum amount decreased. Some authors suggest that the high yields of laccase in white-rot fungi occur when a high concentration of glucose is used as a carbon source [48,49,50]. In addition, Jang et al. [51] suggested that the optimum amount of glucose required for maximum laccase production by Trametes spp. (monoculture) in a submerged culture was 20 g/L of glucose. Mikiashvilil et al. [48] reported that 20 g/L glucose was the optimum carbon resource for laccase production in a monoculture of T. versicolor, which was similar to the amount used in this study. However, Pazarlioglu et al. [52] found a low laccase activity in T. versicolor during submerged fermentation using 1% glucose (10 g/L), but they used a single monoculture and the laccase activity was low (3,000 U/L) compared with the T. maxima used in this study (4,560.9 U/mg protein or 16,433.9 U/L).

The low inoculum amount (two mycelial disks) enhanced laccase activity in T. maxima after co-culturing with P. carneus. This result is different from that obtained by Nandal et al. [53], who reported that laccase activity in Coriolopsis caperata increased as the inoculum concentration rose. It is important to consider that there are many ways to prepare the inoculum for the production of laccase. These include: spore suspension, mycelium, homogenized mycelium and fungal colonized agar plugs [12, 13, 21], and there are no general recommendations with regard to the best inoculation method. Dekker et al. [54] suggests that the use of mycelial disks agar induced fungal growth and enhanced laccase production. According to our PBED results, the amount of mycelial disks used can affect enzyme activity in co-cultures.

CuSO₄ is a metal ion that is necessary for the synthesis and induction of laccase by white-rot fungi [37,40]. However in T. maxima-P. carneus co-cultures, it seems that it is not a key factor, because it's P-value was within specified limits (P > F-value = 0.05) and its percentage P was low at 4.3% ( Table 3). We suggest that the increase in laccase activity is due to the metabolites and enzymes produced by P. carneus and not by the CuSO₄ in the culture medium. In addition, the amount of CuSO₄ present in the Sivakumar culture medium was lower (0.06 mM) than that usually used to induce laccase activity (> 1.5 mM) [50].

According to the ANOVA, the most significant factor for MnP activity was yeast extract concentration, with a P > F-value of 0.005 and a percentage P of 41.3 ( Table 5). The importance of the yeast extract concentration for MnP activity by white-rot fungi has been previously reported by Mikiashvilil et al. [48]. In a previous study, Kamitsuji et al. [43] observed that the highest MnP activity from P. ostreatus was after 8 d of culture in a peptone-glucose-yeast extract medium (0.2 g/L of yeast extract). This amount was lower than that used in the Sivakumar medium, so the high yeast extract levels used in this study could explain the high MnP activity in T. maxima seen in this study.

Regarding to the CaCl₂ its importance in laccase activity has been described previously [55], but not its importance in MnP activity. According to our PBED results, CaCl₂ is an essential factor because there was a slight increase in MnP activity as CaCl₂ levels rose in the culture medium. The function of CaCl₂ in the culture medium is to maintain protein structures and stabilize the activities of several enzymes [56]. Another factor affecting MnP activity was the manganese (Mn) concentration, because Mn is fundamental to the catalytic activity of MnP during the oxidation of Mn^2 + to Mn^3 + in the presence of H₂O₂. In this study, the highest MnP activity was found when the amount of Mn^2 + present was lowest (8th trial run). The amount of Mn^2 + added, in the form of MnSO_4, was 3.3 µM (0.0005 g/L). This metallic ion is essential for the synthesis of MnP by white-rot fungi. Kamitsuji et al. [43] did not find any MnP activity in P. ostreatus in the glucose-yeast extract and peptone-glucose-yeast extract media without the addition of MnSO₄, but when MnSO₄ was added, at a concentration of 270 µM (0.04 g/L), high MnP activity was seen (800 U/L). However, this MnP activity by P. ostreatus was lower than the activity seen in this study using a T. maxima-P. carneus co-culture (564.12 U/mg protein or 1225.4 U/L).

The laccase and MnP activities in the genus Trametes depends on the physiological, nutritional and biochemical nature of the species used, and the strain of the species chosen [37]. However, this study demonstrates that both enzymes can be induced by the presence of soil microfungi, such as P. carneus, and the optimal requirements for enzyme induction in a co-culture system may be different from those required for a monoculture system. Therefore it is necessary to elucidate the mechanism used to increase enzymatic activity in a T. maxima-P. carneus co-culture system and to optimize enzyme production using the most appropriate experimental design, based in the results of this study. Over all it is concluded that the interaction in liquid fermentation, between indigenous T. maxima-P. carneus in co-culture improves laccase and MnP activities. Both the chemical composition of the medium and the timing of when the T. maxima culture is inoculated with the soil microfungus (P. carneus) are important factors for improving enzymatic yield, and finally these results give a basis for further studies into large scale fermentation and production of laccase and MnP in a co-culture system.

Financial support

Agency/Institution: Centro de Investigaciones y de Estudios Avanzados del Instituto Politécnico Nacional (CINVESTAV-IPN, México) and Consejo Nacional de Ciencia y Tecnología (CONACyT-México); Program: Partial support was obtained from Ciencia Básica (CB) CONACyT; Project number: CB 2011/169124.

Acknowledgments

The first author would like to thank CONACyT for a doctoral fellowship, which allowed his studies in INECOL A.C.

Author contributions

Proposed the theoretical frame: WCC, GHA, RRV; Conceived and designed experiments: WCC, GHA, RRV; Contributed reagents/materials/analysis tools: GHA, RRV, DMC; Wrote the paper: WCC, GHA, RRV; Performed the experiments: WCC; Analyzed the data: WCC, RRV, DMC.

 

References

1. Maciel MJ, Castro SA, Telles RHC. Industrial and biotechnological application of ligninolytic enzymes of the basidiomycota: A review. Electron J Biotechnol 2010;13. http://dx.doi.org/10.2225/vol13-issue6-fulltext-2.

2. Gao D, Du L, Yang J, Wu WM, Liang H. A critical reviewof the application of white rot fungus to environmental pollution control. CRC Crit Rev Biotechnol 2010;30:70-7. http://dx.doi.org/10.3109/07388550903427272.

3. Karigar CS, Rao S. Role of microbial enzymes in the bioremediation of pollutants: A review. Enzyme Res 2011;11. http://dx.doi.org/10.4061/2011/805187.

4. Bader J, Mast-Gerlach E, Popovic MK, Bajpai R, Stahl U. Relevance of microbial coculture fermentations in biotechnology. J Appl Microbiol 2010;109:371-87. http://dx.doi.org/10.1111/j.1365-2672.2009.04659.x.

5. Flores C, Vidal C, Trejo HMR, Galindo E, Serrano CL. Selection of Trichoderma strains capable of increasing laccase production by Pleurotus ostreatus and Agaricus bisporus in dual cultures. J Appl Microbiol 2009;106:249-57. http://dx.doi.org/10.1111/j.1365-2672.2008.03998.x.

6. Rivera-Hoyos CM, Morales-Álvarez AED, Poutou-Piñales PRA, Pedroza-Rodríguez RAM, Rodríguez-Vázquez R, Delgado-Boada JM. Fungal laccases. Fungal Biol Rev 2013;27:67-82. http://dx.doi.org/10.1016/j.fbr.2013.07.001.

7. Piscitelli A, Giardina P, Lettera V, Pezzella C, Sannnia G, Faraco V. Induction and transcriptional regulation of laccase in fungi. Curr Genomics 2011;12:104-12. http://dx.doi.org/10.2174/138920211795564331.

8. Parenti A, Muguerza E, Iros AR, Omarini A, Conde E, Alfaro M, et al. Induction of laccase activity in the white rot fungus Pleurotus ostreatus using water polluted with wheat straw extracts. Biotechnol Lett 2013;133:142-9. http://dx.doi.org/10.1016/j.biortech.2013.01.072.

9. Dwivedi P, Vivekanand V, Pareek N, Sharma A, Singh RP. Co-cultivation of mutant Penicillium oxalicum SAUE-3.510 and Pleurotus ostreatus for simultaneous biosynthesis of xylanase and laccase under solid-state fermentation. New Biotechnol 2011;28:616-26. http://dx.doi.org/10.1016/j.nbt.2011.05.006.

10. Savoie JM, Mata G, Billete C. Extracellular laccase production during hyphal interactions between Trichoderma sp. and Shiitake, Lentinula edodes. ApplMicrobiol Biotechnol 1998;49:589-93. http://dx.doi.org/10.1007/s002530051218.

11. Savoie JM, Mata G, Mamoun M. Variability in brown line formation and extracellular laccase production during interaction between white-rot basidiomycetes and Trichoderma harzianum biotype Th2. Mycologia 2001;93:243-8.

12. Baldrian P. Increase of laccase activity during interspecific interactions of white-rot fungi. FEMS Microbiol Ecol 2004;50:245-53. http://dx.doi.org/10.1016/j.femsec.2004.07.005.

13. Mata G, Murrieta-Hernández DM, Iglesias-Andreu LG. Changes in lignocellulolytic enzyme activities in six Pleurotus spp. strains cultivated on coffee pulp in confrontation with Trichoderma spp. World J Microbiol Biotechnol 2005;21:143-50. http://dx.doi.org/10.1007/s11274-004-3041-3.

14. Flores C, Casasanero R, Trejo-Hernández MR, Galindo E, Serrano CL. Production of laccase by Pleurotus ostreatus in submerged fermentation in co-culture with Trichoderma viride. J Appl Microbiol 2010;108:810-7. http://dx.doi.org/10.1111/j.1365-2672.2009.04493.x.

15. Albert S, Chauhan D, Pandya B, Padhiar A. Screening of Trichoderma spp. as potential fungal partner in co-culturing with white rot fungi for efficient bio-pulping. Glob J Biotechnol Biochem 2011;6:95-101.

16. El-Katatny MH, Somitsch W, Robra KH, El-Katatny MS, Gubitz GM. Production of chitinase and β-1,3-glucanase by Trichoderma harzianum for control of the phytopathogenic fungus Sclerotium rolfsii. Food Technol Biotechnol 2000;38:173-80.

17. Mucha J, Dahm H, Strzelczyk E, Werner A. Synthesis of enzymes connected with mycoparasitism by ectomycorrhizal fungi. Arch Microbiol 2006;185:69-77. http://dx.doi.org/10.1007/s00203-005-0068-2.

18. Mucha J. Changes in hyphal morphology and activity of phenoloxidases during interactions between selected ectomycorrhizal fungi and two species of Trichoderma. Antonie Van Leeuwenhoek 2011;100:155-60. http://dx.doi.org/10.1007/s10482-011-9556-3.

19. Zhang H, Hong YZ, Xiao YZ, Yuan J, Tu XM, Zhang XQ. Efficient production of laccase by Trametes sp. AH28-2 in cocultivation with a Trichoderma strain. Appl Microbiol Biotechnol 2006;73:89-94. http://dx.doi.org/10.1007/s00253-006-0430-6.

20. Plackett RL, Burman JP. The design of optimum multifactorial experiments. Biometrica 1946;33:305-25. http://dx.doi.org/10.1093/biomet/33.4.305.

21. Palvannan T, Sathishkumar P. Production of laccase from Pleurotus florida NCIM 1243 using Plackett-Burman design and response surface methodology. J Basic Microbiol 2010;50:325-35. http://dx.doi.org/10.1002/jobm.200900333.

22. Mathur G, Mathur A, Sharma BM, Chauhan RS. Enhanced production of laccase from Coriolus sp. using Plackett-Burman design. J Pharm Res 2013;6:151-4. http://dx.doi.org/10.1016/j.jopr.2012.11.031.

23. Heredia AG, Arias MR. Saprobes and endomycorrhizal fungi in soils. In: Manson RH, Hernández VO, Gallina S, Mehltreter K, editors. Coffee agroecosystems of Veracruz: Biodiversity, conservation and management. Veracruz, México: Institute of Ecology A. C. (INECOL A. C.) and National Institute of Ecology (INE-SEMARNAT); 2008. p. 193-213.

24. Challen MP, Moore AJ, Martínez-Carrera D. Facile extraction and purification of filamentous fungal DNA. Biotechniques 1995;18:975-8.

25. White TJ, Bruns T, Lee S, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA gene for phylogenetics. In: Innis MA, Gelfand DH, Sninsky J, White TJ, editors. PCR protocols, a guide to methods and applications. San Diego CA, USA: Academic Press; 1990. p. 315-22.

26. Huerta G, Martínez CD, Sánchez JE, Leal-Lara E, Vilgalys R. Genetic relationships between Mexican species of Pleurotus analyzing the ITS-region from rDNA. Micol Apl Int 2010;22:15-25.

27. Sivakumar R, Rajedran R, Balakumar C, Tamilvendan M. Isolation, screening and optimization of production medium for thermostable laccase production from Ganoderma sp. Int J Eng Sci Technol 2010;2:7133-41.

28. Koroljova SVO, Stepanova EV, Gavrilova VP, Morozova OV, Lubimova NV,Dzchafarova AN, et al. Purification and characterization of the constitutive form of laccase fromthe basidiomycete Coriolus hirsutus and effect of inducers on laccase synthesis. Biotechnol Appl Biochem 1998;28:47-54.

29. Bose S, Mazumder S, Mukherjee M. Laccase production by the white-rot fungus Termitomyces clypeatus. J Basic Microbiol 2007;47:127-31. http://dx.doi.org/10.1002/jobm.200610206.

30. Bourbonnais R, Paice M. Veratryl Alcohol oxidases from the lignin-degrading basidiomycestes Pleurotus sajor-caju. Biochem J 1988;255:445-50.

31. Glenn JK, Gol MH. Decolorization of several polymeric dyes by the lignin-degrading basidiomycete Phanerochaete chrysosporium. Appl EnvironMicrobiol 1983;45:1741-7.

32. Bradford M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248-54. http://dx.doi.org/10.1016/0003-2697(76)90527-3.

33. Justo A, Hibbett D. Phylogenetic classification of Trametes (Basidiomycota, Polyporales) based on a five-marker dataset. Taxon 2011;60:1567-83.

34. Yokoyama E, Arakawa M, Yamagishi K, Hara A. Phylogenetic and structural analyses of mating-type loci in Clavicipitaceae. FEMS Microbiol Ecol 2006;264:182-91. http://dx.doi.org/10.1111/j.1574-6968.2006.00447.x.

35. De Bellis T, Kernaghan G, Widden P. Plant community influences on soil microfungal assemblages in boreal mixed-wood forest. Mycologia 2007;99:356-67. http://dx.doi.org/10.3852/mycologia.99.3.356.

36. Sánchez-Márquez S, Bills GF, Domínguez-Acuña L, Zabalgogeazcoa I. Endophytic mycobiota of leaves and roots of the grass Holcus lanatus. Fungal Divers 2010; 41:115-23. http://dx.doi.org/10.1007/s13225-009-0015-7.

37. Elisashvili V, Torokb T, Kachlishvilia E, Khardziania T, Metrevelo E, Kobakhidze A, et al. Evaluation and regulation of lignocellulolytic activity of novel white-rot basidiomycetes. Glob J Biotechnol Biochem 2011;2:134-41.

38. Kumarasamy M, Young-Mo K, Jong-Rok J, Yoon-Seok C. Effect of metal ions on reactive dye decolorization by laccase from Ganoderma lucidum. J Hazard Mater 2009;168:523-9. http://dx.doi.org/10.1016/j.jhazmat.2009.02.075.

39. Songulashvili G, Elisashvili E, Wasser SP, Nevo E, Hadar Y. Basidiomycetes laccase and manganese peroxidase activity in submerged fermentation of food industry wastes. Enzyme Microb Technol 2007;41:57-61. http://dx.doi.org/10.1016/j.enzmictec.2006.11.024.

40. Rodríguez CS, Gundín M, Lorenzo M, Sanromán A. Screening of supports and inducers for laccase production by Trametes versicolor in semi-solid-state conditions. Process Biochem 2002;38:249-55. http://dx.doi.org/10.1016/S0032-9592(02)00087-0.

41. González LF, Sarria V, Sánchez OF. Degradation of chlorophenols by sequential biological-advance oxidative process using Trametes pubescens and TiO2/UV. Bioresour Technol 2010;101:3493-9. http://dx.doi.org/10.1016/j.biortech.2009.12.130.

42. Zouari MH, Mechini T, Dhouib A, Sayadi S, Martínez AT, Martínez MJ. Laccase purification and characterization from Trametes trogii isolated in Tunisia: Decolorization of textile dyes by purified enzyme. Enzyme Microb Technol 2006;39:141-8. http://dx.doi.org/10.1016/j.enzmictec.2005.11.027.

43. Kamitsuji H, Honda Y, Watanabe T, Kuwahara M. Mn2+ is dispensable for the production of active MnP2 by Pleurotus ostreatus. Biochem Biophys Res Commun 2005;327:871-6. http://dx.doi.org/10.1016/j.bbrc.2004.12.084.

44. Lorenzo M, Moldes M, Rodríguez-Couto S, Sanromán A. Improving laccase production by employing different lignocellulosic waste in submerged cultures of Trametes versicolor. Bioresour Technol 2002;82:109-13. http://dx.doi.org/10.1016/S0960-8524(01)00176-6.

45. Qi-He C, Krügener S, Hirth T, Rupp S, Zibek S. Co-culture producing of lignin-modifying enzymes with white-rot fungi. Appl Biochem Biotechnol 2011;165:700-18. http://dx.doi.org/10.1007/s12010-011-9289-9.

46. Velázquez-Cedeño MA, Farnet AM, Ferré E, Savoie JM. Variation of lignocellulosic activities in dual cultures of Pleurotus ostreatus and Trichoderma longibrachiatum on unsterilized wheat straw. Mycologia 2004;96:712-9.

47. Chi Y, Hatakka A, Maijala P. Can co-culturing of two white-rot fungi increase lignin degradation and the production of lignin-degrading enzymes? Int Biodeterior Biodegrad 2007;59:32-9. http://dx.doi.org/10.1016/j.ibiod.2006.06.025.

48. Mikiashvilil N, Elisashvili V, Wasser S, Nevol E. Carbon and nitrogen sources influence the ligninolytic enzyme activity of Trametes versicolor. Biotechnol Lett 2005;27:955-9. http://dx.doi.org/10.1007/s10529-005-7662-x.

49. Jing D, Li P, Stagnitti F, Xiong X. Optimization of laccase production from Trametes versicolor by solid fermentation. Can J Microbiol 2007;53:245-51. http://dx.doi.org/10.1139/W06-121.

50. Eugenio ME, Carbajo JM, Martín JA, González AE, Villar JC. Laccase production by Pycnoporus sanguineus under different culture conditions. J Basic Microbiol 2009; 49:433-40. http://dx.doi.org/10.1002/jobm.200800347.

51. Jang MY, Ryu WR, Cho MH. Laccase production from repeated batch cultures using free mycelia of Trametes sp. Enzyme Microb Technol 2002;30:741-6. http://dx.doi.org/10.1016/S0141-0229(02)00051-0.

52. Pazarlioglu NK, Sariisik M, Telefoncu A. Laccase: Production Trametes versicolor and application to denim washing. Process Biochem 2005;40:1673-8. http://dx.doi.org/10.1016/j.procbio.2004.06.052.

53. Nandal P, Ravella SR, Kuhad RC. Laccase production by Coriolopsis caperata RCK2011: Optimization under solid state fermentation by Taguchi DOE methodology. Sci Rep 2013;3:1-7. http://dx.doi.org/10.1038/srep01386.

54. Dekker RFH, Barbosa AM, Giese EC, Godoy SD, Covizzi LG. Influence of nutrients on enhancing laccase production by Botryosphaeria rhodina MAMB-05. Int Microbiol 2007;10:177-85. http://dx.doi.org/10.2436/20.1501.01.25.

55. Jegatheesan M, Senthilkumaran M, Eyini M. Enhanced production of laccase enzyme by the white-rot mushroom fungus Pleurotus florida using response surface methodology. Int J Curr Res 2012;4:25-31.

56. Neifar M, Kamoun A, Jaouani A, Ellouze GR, Ellouze CS. Application of asymmetrical and Hoke designs for optimization of laccase production by the white-rot fungus Fomes fomentarius in solid-state fermentation. Enzyme Res 2011;12. http://dx.doi.org/10.4061/2011/368525.

 

---

*Corresponding author: E-mail address: rerovaz@gmail.com (R. Rodríguez Vázquez).

Received 25 September 2013, Accepted 15 January 2014, Available online 9 May 2014.

Copyright © 2014 Pontificia Universidad Católica de Valparaíso. Production and hosting by Elsevier B.V. All rights reserved. Peer review under responsibility of Pontificia Universidad Católica de Valparaíso.